ABHD10 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14439-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ABHD10 Reagents
CRO Services
Product recommended

All ABHD10 Reagents
ABHD10 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
921 bp
Description
Full length Clone DNA of Human abhydrolase domain containing 10 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ABHD10 cDNA ORF Clone, Human, N-Myc tag Alternative Names
ABHD10 cDNA ORF Clone, Human
ABHD10 Background Information

Mycophenolic acid (MPA), the active metabolite of the immunosuppressant mycophenolate mofetil (MMF), is primarily metabolized by glucuronidation to a phenolic glucuronide (MPAG) and an acyl glucuronide (AcMPAG). It is known that AcMPAG, which may be an immunotoxic metabolite, is deglucuronidated in human liver. AcMPAG deglucuronidation activity was detected in both human liver cytosol (HLC) and microsomes (HLM). By purification from HLC with column chromatographic purification steps, the enzyme responsible for AcMPAG deglucuronidationis identified as α/β hydrolase domain containing 10 (ABHD10). Recombinant ABHD10 expressed in Sf9 cells efficiently deglucuronidated AcMPAG with a K(m) value of 100.7 ± 10.2 μM, which was similar to those in HLM, HLC, and human liver homogenates (HLH). Immunoblot analysis revealed ABHD10 protein expression in both HLC and HLM. The AcMPAG deglucuronidation by recombinant ABHD10, HLC, and HLH were potently inhibited by AgNO(3), CdCl(2), CuCl(2), PMSF, bis-p-nitrophenylphosphate, and DTNB. The CL(int) value of AcMPAG formation from MPA, which was catalyzed by human UGT2B7, in HLH was increased by 1.8-fold in the presence of PMSF. Thus, human ABHD10 would affect the formation of AcMPAG, the immunotoxic metabolite.

Full Name
abhydrolase domain containing 10
References
  • Nardini M. et al., 1999, Curr Opin Struct Biol. 9 (6): 732-7.
  • Carr PD. et al., 2009, Protein Pept Lett. 16 (10): 1137-48.
  • Cheah E. et al., 1992, Protein Eng. 5 (3): 197-211.
  • Iwamura A. et al., 2012, J Biol Chem. 287 (12): 9240-9.
  • ABHD10 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ABHD10 cDNA ORF Clone in Cloning Vector, Rat RG8A0028-U
    ABHD10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0028-ACGLN

    ABHD10 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ABHD10 cDNA ORF Clone in Cloning Vector, Mouse MG53725-U
    ABHD10 cDNA ORF Clone, Mouse, untagged MG53725-UT
    ABHD10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53725-ACGLN
    ABHD10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53725-ACG
    ABHD10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53725-ANG
    ABHD10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53725-ACR
    ABHD10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53725-ANR
    ABHD10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53725-CF
    ABHD10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53725-NF
    ABHD10 cDNA ORF Clone, Mouse, C-His tag MG53725-CH
    ABHD10 cDNA ORF Clone, Mouse, N-His tag MG53725-NH
    ABHD10 cDNA ORF Clone, Mouse, C-HA tag MG53725-CY
    ABHD10 cDNA ORF Clone, Mouse, N-HA tag MG53725-NY
    ABHD10 cDNA ORF Clone, Mouse, C-Myc tag MG53725-CM
    ABHD10 cDNA ORF Clone, Mouse, N-Myc tag MG53725-NM

    ABHD10 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ABHD10 cDNA ORF Clone in Cloning Vector, Human HG14439-G
    ABHD10 cDNA ORF Clone, Human, untagged HG14439-UT
    ABHD10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14439-ACGLN
    ABHD10 cDNA ORF Clone, Human, C-GFPSpark® tag HG14439-ACG
    ABHD10 cDNA ORF Clone, Human, N-GFPSpark® tag HG14439-ANG
    ABHD10 cDNA ORF Clone, Human, C-OFPSpark® tag HG14439-ACR
    ABHD10 cDNA ORF Clone, Human, N-OFPSpark® tag HG14439-ANR
    ABHD10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14439-CF
    ABHD10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14439-NF
    ABHD10 cDNA ORF Clone, Human, C-His tag HG14439-CH
    ABHD10 cDNA ORF Clone, Human, N-His tag HG14439-NH
    ABHD10 cDNA ORF Clone, Human, C-HA tag HG14439-CY
    ABHD10 cDNA ORF Clone, Human, N-HA tag HG14439-NY
    ABHD10 cDNA ORF Clone, Human, C-Myc tag HG14439-CM
    ABHD10 qPCR Primer Pairs, Human HP103087
    info info
    添加购物车成功! 添加购物车失败!