Quick Order

Human ABCE1 Gene ORF cDNA clone expression plasmid

  • Human IL12A / IL-12A Gene Plasmid Map 5647
DatasheetReviewsRelated ProductsProtocols
Human ABCE1 cDNA Clone Product Information
NCBI RefSeq:BC016283
RefSeq ORF Size:1800bp
cDNA Description:Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family E (OABP), member 1.
Gene Synonym:RLI, OABP, ABC38, RNS4I, RNASEL1, RNASELI
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ABCE1
Restriction Site:KpnI + NotI(6.1kb+1.8kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ABCE1 qPCR primers for gene expression analysis, HP104124 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG15502-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"