Quick Order

Human ABCB1 Gene ORF cDNA clone expression plasmid

  • Human ABCB1 natural ORF mammalian expression plasmid
DatasheetReviewsRelated ProductsProtocols
Human ABCB1 cDNA Clone Product Information
NCBI RefSeq:NM_000927
RefSeq ORF Size:3843bp
cDNA Description:Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 1.
Gene Synonym:P-gp, CD243, GP170, ABC20
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-ABCB1
Restriction Site:KpnI (two restriction sites) + XbaI (6.1kb + 2.82kb + 1.07kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 3435T>C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ABCB1 qPCR primers for gene expression analysis, HP101566 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ABCB1 Gene Plasmid Map
Human ABCB1 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG12030-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"