alanyl-tRNA synthetase cDNA ORF Clone, Human, N-Myc tag

Cat: HG10951-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All alanyl-tRNA synthetase Reagents
CRO Services
Product recommended

All alanyl-tRNA synthetase Reagents
alanyl-tRNA synthetase cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2907 bp
Description
Full length Clone DNA of Human alanyl-tRNA synthetase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

alanyl-tRNA synthetase cDNA ORF Clone, Human, N-Myc tag Alternative Names
CMT2N cDNA ORF Clone, Human
alanyl-tRNA synthetase Background Information

Alanyl-tRNA synthetase (AARS) belongs to the family of ligases, specifically those forming carbon-oxygen bonds in aminoacyl-tRNA and related compounds. This enzyme participates in alanine and aspartate metabolism and aminoacyl-tRNA biosynthesis. Alanyl-tRNA synthetase (AlaRS) catalyzes synthesis of Ala-tRNA (Ala) and hydrolysis of mis-acylated Ser- and Gly-tRNA (Ala) at 2 different catalytic sites. Their role is not confined to catalyze the attachment of amino acids to transfer RNAs and thereby establish the rules of genetic code by virtue of matching the nucleotide triplet of anticodon with cognate amino acid. Under apoptotic conditions in cell culture, the full-length enzyme is secreted, and the two cytokine activities can be generated by leukocyte elastase, an extracellular protease. Secretion of this tRNA synthetase may contribute to apoptosis both by arresting translation and producing needed cytokines. This protein could be an attractive target of drugs against bacterial, fungal and parasitic infections. 

Full Name
alanyl-tRNA synthetase
References
  • Wakasugi K, et al. (1999) Two Distinct Cytokines Released from a Human Aminoacyl-tRNA Synthetase. Science. 284 (5411): 147-51.
  • Sokabe M, et al. (2009) The structure of alanyl-tRNA synthetase with editing domain. Proc Natl Acad Sci . 106 (27): 11028-33.
  • Skupinska M, et al. (2009) AARS--the etiological factor and the attractive target of many disorders. Postepy Biochem. 55 (4): 373-84.
  • info info
    添加购物车成功! 添加购物车失败!