Adracalin cDNA ORF Clone, Human, C-Myc tag

Cat: HG14285-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Adracalin Reagents
CRO Services
Product recommended

All Adracalin Reagents
Adracalin cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1641 bp
Description
Full length Clone DNA of Human achalasia, adrenocortical insufficiency, alacrimia with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Adracalin cDNA ORF Clone, Human, C-Myc tag Alternative Names
AAA cDNA ORF Clone, Human;AAASb cDNA ORF Clone, Human;ADRACALA cDNA ORF Clone, Human;ADRACALIN cDNA ORF Clone, Human;ALADIN cDNA ORF Clone, Human;GL003 cDNA ORF Clone, Human
Adracalin Background Information
Full Name
achalasia, adrenocortical insufficiency, alacrimia

Adracalin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Adracalin cDNA ORF Clone in Cloning Vector, Mouse MG53491-G
Adracalin cDNA ORF Clone, Mouse, untagged MG53491-UT
Adracalin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53491-ACGLN
Adracalin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53491-ACG
Adracalin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53491-ANG
Adracalin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53491-ACR
Adracalin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53491-ANR
Adracalin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53491-CF
Adracalin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53491-NF
Adracalin cDNA ORF Clone, Mouse, C-His tag MG53491-CH
Adracalin cDNA ORF Clone, Mouse, N-His tag MG53491-NH
Adracalin cDNA ORF Clone, Mouse, C-HA tag MG53491-CY
Adracalin cDNA ORF Clone, Mouse, N-HA tag MG53491-NY
Adracalin cDNA ORF Clone, Mouse, C-Myc tag MG53491-CM
Adracalin cDNA ORF Clone, Mouse, N-Myc tag MG53491-NM

Adracalin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Adracalin cDNA ORF Clone in Cloning Vector, Human HG14285-G
Adracalin cDNA ORF Clone, Human, untagged HG14285-UT
Adracalin cDNA ORF Clone, Human, C-GFPSpark® tag HG14285-ACG
Adracalin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14285-ACGLN
Adracalin cDNA ORF Clone, Human, N-GFPSpark® tag HG14285-ANG
Adracalin cDNA ORF Clone, Human, C-OFPSpark® tag HG14285-ACR
Adracalin cDNA ORF Clone, Human, N-OFPSpark® tag HG14285-ANR
Adracalin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14285-CF
Adracalin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14285-NF
Adracalin cDNA ORF Clone, Human, C-His tag HG14285-CH
Adracalin cDNA ORF Clone, Human, N-His tag HG14285-NH
Adracalin cDNA ORF Clone, Human, C-HA tag HG14285-CY
Adracalin cDNA ORF Clone, Human, N-HA tag HG14285-NY
Adracalin cDNA ORF Clone, Human, N-Myc tag HG14285-NM
Adracalin qPCR Primer Pairs, Human HP102935
info info
添加购物车成功! 添加购物车失败!