A4GALT cDNA ORF Clone, Human, C-HA tag

Cat: HG14180-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All A4GALT Reagents
CRO Services
Product recommended

All A4GALT Reagents
A4GALT cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1062 bp
Description
Full length Clone DNA of Human alpha 1,4-galactosyltransferase with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

A4GALT Background Information
Full Name
alpha 1,4-galactosyltransferase

A4GALT cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
A4GALT cDNA ORF Clone in Cloning Vector, Mouse MG50733-G
A4GALT cDNA ORF Clone, Mouse, untagged MG50733-UT
A4GALT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50733-ACG
A4GALT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50733-ACGLN
A4GALT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50733-ACR
A4GALT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50733-CF
A4GALT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50733-NF
A4GALT cDNA ORF Clone, Mouse, C-His tag MG50733-CH
A4GALT cDNA ORF Clone, Mouse, N-His tag MG50733-NH
A4GALT cDNA ORF Clone, Mouse, C-HA tag MG50733-CY
A4GALT cDNA ORF Clone, Mouse, N-HA tag MG50733-NY
A4GALT cDNA ORF Clone, Mouse, C-Myc tag MG50733-CM
A4GALT cDNA ORF Clone, Mouse, N-Myc tag MG50733-NM
A4GALT qPCR Primer Pairs, Mouse MP200708

A4GALT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
A4GALT cDNA ORF Clone in Cloning Vector, Human HG14180-G
A4GALT cDNA ORF Clone, Human, untagged HG14180-UT
A4GALT cDNA ORF Clone, Human, C-GFPSpark® tag HG14180-ACG
A4GALT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14180-ACGLN
A4GALT cDNA ORF Clone, Human, C-OFPSpark® tag HG14180-ACR
A4GALT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14180-CF
A4GALT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14180-NF
A4GALT cDNA ORF Clone, Human, C-His tag HG14180-CH
A4GALT cDNA ORF Clone, Human, N-His tag HG14180-NH
A4GALT cDNA ORF Clone, Human, N-HA tag HG14180-NY
A4GALT cDNA ORF Clone, Human, C-Myc tag HG14180-CM
A4GALT cDNA ORF Clone, Human, N-Myc tag HG14180-NM
A4GALT qPCR Primer Pairs, Human HP102831
info info
添加购物车成功! 添加购物车失败!