2B4 / CD244 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10042-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All 2B4 / CD244 Reagents
CRO Services
Product recommended

All 2B4 / CD244 Reagents
2B4 / CD244 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1098 bp
Description
Full length Clone DNA of Human CD244 molecule, natural killer cell receptor 2B4 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

2B4 / CD244 cDNA ORF Clone, Human, C-Myc tag Alternative Names
2B4 cDNA ORF Clone, Human;NAIL cDNA ORF Clone, Human;NKR2B4 cDNA ORF Clone, Human;Nmrk cDNA ORF Clone, Human;SLAMF4 cDNA ORF Clone, Human
2B4 / CD244 Background Information

The CD244 antigen, also known as 2B4, is a cell surface glycoprotein implicated in the regulation of natural killer and T lymphocyte function. 2B4 is a member of the signaling lymphocyte activation molecule (SLAM)-related receptor family and is important for stimulating NK cell cytotoxicity and cytokine production, which is expressed on all NK cells, a subpopulation of T cells, monocytes and basophils. The 2B4 antigen identified on NK cells and T cells is capable of transmitting stimulatory signals and non-MHC-restricted killing. Reported as an activating receptor, human 2B4 can effectively activate and enhance NK cell–mediated cytotoxicity, induce secretion of IFN-γ and matrix metalloproteinases (MMPs), as well as NK cell invasiveness. As a cell surface glycoprotein of the Ig-superfamily structurally related to CD2-like molecules such as CD2, CD48, CD58, CD84, Ly-9, and SLAM, 2B4 (CD244) is expressed on all human NK cells, a subpopulation of T cells, basophils and monocytes. 2B4 activates NK cell mediated cytotoxicity, induces secretion of IFN-gamma and matrix metalloproteinases, and NK cell invasiveness.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD244 molecule, natural killer cell receptor 2B4
References
  • Nakajima H, et al. (2000) 2B4: an NK cell activating receptor with unique specificity and signal transduction mechanism. Hum Immunol. 61(1): 39-43.
  • Chuang SS, et al. (2001) 2B4 (CD244)-mediated activation of cytotoxicity and IFN-gamma release in human NK cells involves distinct pathways. J Immunol. 167(11): 6210-6.
  • McNerney ME, et al. (2005) 2B4 (CD244) is a non-MHC binding receptor with multiple functions on natural killer cells and CD8+ T cells. Mol Immunol. 42(4): 489-94.
  • Mathew SO, et al. (2009) Functional role of human NK cell receptor 2B4 (CD244) isoforms. Eur J Immunol. 39(6): 1632-41.
  • info info
    添加购物车成功! 添加购物车失败!