Hepatitis C virus (HCV-2a) Core ORF mammalian expression plasmid, C-HA tag

Cat: VG40289-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HCV-Core Reagents
CRO Services
Product recommended

All HCV-Core Reagents
Hepatitis C virus (HCV-2a) Core ORF mammalian expression plasmid, C-HA tag General Information
Gene
Species
HCV
NCBI Ref Seq
RefSeq ORF Size
576 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Hepatitis C virus (HCV) (serotype 2a, isolate JFH-1) Core with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HCV-Core Background Information

HCV-Core cDNA ORF Clone, HCV, Related Products

Product Name Catalog#(PDF)
Hepatitis C virus (HCV-1a) Core ORF mammalian expression plasmid (Codon Optimized) VG40278-G
Hepatitis C virus (HCV-2a) Core ORF mammalian expression plasmid (Codon Optimized) VG40289-G
Hepatitis C virus (HCV-3a) Core ORF mammalian expression plasmid (Codon Optimized) VG40292-G
Hepatitis C virus (HCV-2b) Core ORF mammalian expression plasmid (Codon Optimized) VG40290-G
Hepatitis C virus (HCV-2c) Core ORF mammalian expression plasmid (Codon Optimized) VG40291-G
Hepatitis C virus (HCV-3b) Core ORF mammalian expression plasmid (Codon Optimized) VG40293-G
Hepatitis C virus (HCV-1b) Core ORF mammalian expression plasmid (Codon Optimized) VG40287-G
Hepatitis C virus (HCV-1c) Core ORF mammalian expression plasmid (Codon Optimized) VG40288-G
Hepatitis C virus (HCV-1c) Core natural ORF mammalian expression plasmid VG40288-UT
Hepatitis C virus (HCV-2c) Core natural ORF mammalian expression plasmid VG40291-UT
Hepatitis C virus (HCV-3b) Core natural ORF mammalian expression plasmid VG40293-UT
Hepatitis C virus (HCV-1a) Core natural ORF mammalian expression plasmid VG40278-UT
Hepatitis C virus (HCV-1b) Core natural ORF mammalian expression plasmid VG40287-UT
Hepatitis C virus (HCV-2a) Core natural ORF mammalian expression plasmid VG40289-UT
Hepatitis C virus (HCV-2b) Core natural ORF mammalian expression plasmid VG40290-UT
Hepatitis C virus (HCV-3a) Core natural ORF mammalian expression plasmid VG40292-UT
Hepatitis C virus (HCV-2c) Core ORF mammalian expression plasmid, C-GFPSpark tag VG40291-ACG
Hepatitis C virus (HCV-2c) Core Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40291-ACGLN
Hepatitis C virus (HCV-1a) Core Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40278-ACGLN
Hepatitis C virus (HCV-3b) Core ORF mammalian expression plasmid, C-GFPSpark tag VG40293-ACG
Hepatitis C virus (HCV-1b) Core Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40287-ACGLN
Hepatitis C virus (HCV-1b) Core ORF mammalian expression plasmid, C-GFPSpark tag VG40287-ACG
Hepatitis C virus (HCV-3a) Core ORF mammalian expression plasmid, C-GFPSpark tag VG40292-ACG
Hepatitis C virus (HCV-1a) Core ORF mammalian expression plasmid, C-GFPSpark tag VG40278-ACG
Hepatitis C virus (HCV-2b) Core Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40290-ACGLN
Hepatitis C virus (HCV-3a) Core Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40292-ACGLN
Hepatitis C virus (HCV-2a) Core Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40289-ACGLN
Hepatitis C virus (HCV-1c) Core ORF mammalian expression plasmid, C-GFPSpark tag VG40288-ACG
Hepatitis C virus (HCV-3b) Core Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40293-ACGLN
Hepatitis C virus (HCV-2b) Core ORF mammalian expression plasmid, C-GFPSpark tag VG40290-ACG
Hepatitis C virus (HCV-2a) Core ORF mammalian expression plasmid, C-GFPSpark tag VG40289-ACG
Hepatitis C virus (HCV-1c) Core Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40288-ACGLN
Hepatitis C virus (HCV-1c) Core ORF mammalian expression plasmid, N-GFPSpark tag VG40288-ANG
Hepatitis C virus (HCV-2c) Core ORF mammalian expression plasmid, N-GFPSpark tag VG40291-ANG
Hepatitis C virus (HCV-2b) Core ORF mammalian expression plasmid, N-GFPSpark tag VG40290-ANG
Hepatitis C virus (HCV-1b) Core ORF mammalian expression plasmid, N-GFPSpark tag VG40287-ANG
Hepatitis C virus (HCV-3a) Core ORF mammalian expression plasmid, N-GFPSpark tag VG40292-ANG
Hepatitis C virus (HCV-1a) Core ORF mammalian expression plasmid, N-GFPSpark tag VG40278-ANG
Hepatitis C virus (HCV-2a) Core ORF mammalian expression plasmid, N-GFPSpark tag VG40289-ANG
Hepatitis C virus (HCV-3b) Core ORF mammalian expression plasmid, N-GFPSpark tag VG40293-ANG
Hepatitis C virus (HCV-3b) Core ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40293-ACR
Hepatitis C virus (HCV-1c) Core ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40288-ACR
Hepatitis C virus (HCV-1a) Core ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40278-ACR
Hepatitis C virus (HCV-2b) Core ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40290-ACR
Hepatitis C virus (HCV-2a) Core ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40289-ACR
Hepatitis C virus (HCV-2c) Core ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40291-ACR
Hepatitis C virus (HCV-1b) Core ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40287-ACR
Hepatitis C virus (HCV-3a) Core ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40292-ACR
Hepatitis C virus (HCV-2b) Core ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40290-ANR
Hepatitis C virus (HCV-3b) Core ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40293-ANR
Hepatitis C virus (HCV-2c) Core ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40291-ANR
Hepatitis C virus (HCV-2a) Core ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40289-ANR
Hepatitis C virus (HCV-1b) Core ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40287-ANR
Hepatitis C virus (HCV-1c) Core ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40288-ANR
Hepatitis C virus (HCV-1a) Core ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40278-ANR
Hepatitis C virus (HCV-3a) Core ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40292-ANR
Hepatitis C virus (HCV-1b) Core Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged VG40287-CF
Hepatitis C virus (HCV-3a) Core Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged VG40292-CF
Hepatitis C virus (HCV-2c) Core Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged VG40291-CF
Hepatitis C virus (HCV-2b) Core Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged VG40290-CF
Hepatitis C virus (HCV-1a) Core Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged VG40278-CF
Hepatitis C virus (HCV-3b) Core Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged VG40293-CF
Hepatitis C virus (HCV-2a) Core Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged VG40289-CF
Hepatitis C virus (HCV-1c) Core Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged VG40288-CF
Hepatitis C virus (HCV-1b) Core ORF mammalian expression plasmid, N-Flag tag VG40287-NF
Hepatitis C virus (HCV-2c) Core ORF mammalian expression plasmid, N-Flag tag VG40291-NF
Hepatitis C virus (HCV-3a) Core ORF mammalian expression plasmid, N-Flag tag VG40292-NF
Hepatitis C virus (HCV-2a) Core ORF mammalian expression plasmid, N-Flag tag VG40289-NF
Hepatitis C virus (HCV-2b) Core ORF mammalian expression plasmid, N-Flag tag VG40290-NF
Hepatitis C virus (HCV-1c) Core ORF mammalian expression plasmid, N-Flag tag VG40288-NF
Hepatitis C virus (HCV-3b) Core ORF mammalian expression plasmid, N-Flag tag VG40293-NF
Hepatitis C virus (HCV-1a) Core ORF mammalian expression plasmid, N-Flag tag VG40278-NF
Hepatitis C virus (HCV-1b) Core ORF mammalian expression plasmid, C-His tag VG40287-CH
Hepatitis C virus (HCV-2c) Core ORF mammalian expression plasmid, C-His tag VG40291-CH
Hepatitis C virus (HCV-1c) Core ORF mammalian expression plasmid, C-His tag VG40288-CH
Hepatitis C virus (HCV-3a) Core ORF mammalian expression plasmid, C-His tag VG40292-CH
Hepatitis C virus (HCV-2b) Core ORF mammalian expression plasmid, C-His tag VG40290-CH
Hepatitis C virus (HCV-1a) Core ORF mammalian expression plasmid, C-His tag VG40278-CH
Hepatitis C virus (HCV-3b) Core ORF mammalian expression plasmid, C-His tag VG40293-CH
Hepatitis C virus (HCV-2a) Core ORF mammalian expression plasmid, C-His tag VG40289-CH
Hepatitis C virus (HCV-2a) Core ORF mammalian expression plasmid, N-His tag VG40289-NH
Hepatitis C virus (HCV-3b) Core ORF mammalian expression plasmid, N-His tag VG40293-NH
Hepatitis C virus (HCV-1c) Core ORF mammalian expression plasmid, N-His tag VG40288-NH
Hepatitis C virus (HCV-2b) Core ORF mammalian expression plasmid, N-His tag VG40290-NH
Hepatitis C virus (HCV-3a) Core ORF mammalian expression plasmid, N-His tag VG40292-NH
Hepatitis C virus (HCV-1a) Core ORF mammalian expression plasmid, N-His tag VG40278-NH
Hepatitis C virus (HCV-1b) Core ORF mammalian expression plasmid, N-His tag VG40287-NH
Hepatitis C virus (HCV-2c) Core ORF mammalian expression plasmid, N-His tag VG40291-NH
Hepatitis C virus (HCV-1b) Core ORF mammalian expression plasmid, C-HA tag VG40287-CY
Hepatitis C virus (HCV-2c) Core ORF mammalian expression plasmid, C-HA tag VG40291-CY
Hepatitis C virus (HCV-1c) Core ORF mammalian expression plasmid, C-HA tag VG40288-CY
Hepatitis C virus (HCV-3b) Core ORF mammalian expression plasmid, C-HA tag VG40293-CY
Hepatitis C virus (HCV-1a) Core ORF mammalian expression plasmid, C-HA tag VG40278-CY
Hepatitis C virus (HCV-2b) Core ORF mammalian expression plasmid, C-HA tag VG40290-CY
Hepatitis C virus (HCV-3a) Core ORF mammalian expression plasmid, C-HA tag VG40292-CY
Hepatitis C virus (HCV-1b) Core ORF mammalian expression plasmid, N-HA tag VG40287-NY
Hepatitis C virus (HCV-2b) Core ORF mammalian expression plasmid, N-HA tag VG40290-NY
Hepatitis C virus (HCV-1c) Core ORF mammalian expression plasmid, N-HA tag VG40288-NY
Hepatitis C virus (HCV-2a) Core ORF mammalian expression plasmid, N-HA tag VG40289-NY
Hepatitis C virus (HCV-2c) Core ORF mammalian expression plasmid, N-HA tag VG40291-NY
Hepatitis C virus (HCV-3b) Core ORF mammalian expression plasmid, N-HA tag VG40293-NY
Hepatitis C virus (HCV-1a) Core ORF mammalian expression plasmid, N-HA tag VG40278-NY
Hepatitis C virus (HCV-3a) Core ORF mammalian expression plasmid, N-HA tag VG40292-NY
Hepatitis C virus (HCV-3b) Core ORF mammalian expression plasmid, C-Myc tag VG40293-CM
Hepatitis C virus (HCV-2b) Core ORF mammalian expression plasmid, C-Myc tag VG40290-CM
Hepatitis C virus (HCV-3a) Core ORF mammalian expression plasmid, C-Myc tag VG40292-CM
Hepatitis C virus (HCV-2c) Core ORF mammalian expression plasmid, C-Myc tag VG40291-CM
Hepatitis C virus (HCV-1a) Core ORF mammalian expression plasmid, C-Myc tag VG40278-CM
Hepatitis C virus (HCV-2a) Core ORF mammalian expression plasmid, C-Myc tag VG40289-CM
Hepatitis C virus (HCV-1b) Core ORF mammalian expression plasmid, C-Myc tag VG40287-CM
Hepatitis C virus (HCV-1c) Core ORF mammalian expression plasmid, C-Myc tag VG40288-CM
Hepatitis C virus (HCV-1c) Core ORF mammalian expression plasmid, N-Myc tag VG40288-NM
Hepatitis C virus (HCV-3a) Core ORF mammalian expression plasmid, N-Myc tag VG40292-NM
Hepatitis C virus (HCV-2c) Core ORF mammalian expression plasmid, N-Myc tag VG40291-NM
Hepatitis C virus (HCV-3b) Core ORF mammalian expression plasmid, N-Myc tag VG40293-NM
Hepatitis C virus (HCV-2b) Core ORF mammalian expression plasmid, N-Myc tag VG40290-NM
Hepatitis C virus (HCV-1a) Core ORF mammalian expression plasmid, N-Myc tag VG40278-NM
Hepatitis C virus (HCV-2a) Core ORF mammalian expression plasmid, N-Myc tag VG40289-NM
Hepatitis C virus (HCV-1b) Core ORF mammalian expression plasmid, N-Myc tag VG40287-NM
info info
添加购物车成功! 添加购物车失败!