Our new search engine has been launched. Welcome to use it and experience it. If you have any suggestions, welcome to contact us!
Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Mouse TNFRSF14 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Mouse TNFRSF14 Gene Plasmid Map
Mouse HVEM / TNFRSF14 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Herpesvirus entry mediator (HVEM), also referred to as TNFRSF14, TR2 (TNF receptor-like molecule) and ATAR (another TRAF-associated receptor), is a member of type I transmembrane protein belonging to the TNF-receptor superfamily. It is expressed on many immune cells, including T and B cells, NK cells, monocytes, and neutrophils. Two TNF superfamily ligands lymphotoxin α (TNF-β) and LIGHT (TNFSF14) are identified as cellular ligands for HVEM and initiate the positive signaling. However, recent studies have revealed that HVEM is also involved in the unique inhibitory signaling pathway for T cells through activating tyrosine phosphorylation of the immunoreceptor tyrosine-based inhibitory motif (ITIM) in B and T lymphocyte attenuator (BTLA). HVEM provides a stimulatory signal following engagement with LIGHT (TNFSF14) on T cells. In contrast, it can also provide an inhibitory signal to T cells when it binds the B and T lymphocyte attenuator (BTLA), a ligand member of the Immunoglobulin (Ig) superfamily. Thus, HVEM may be viewed as a molecular switch, capable of facilitating both stimulatory and inhibitory cosignaling in T cells. Substantial evidence from both human disease and from experimental mouse models has indicated that dysregulation of the LIGHT-HVEM-BTLA cosignaling pathway can cause inflammation in the lung and in mucosal tissues.

  • Murphy KM, et al. (2006) Balancing co-stimulation and inhibition with BTLA and HVEM. Nat Rev Immunol. 6(9): 671-81.
  • Heo SK, et al. (2007) HVEM signaling in monocytes is mediated by intracellular calcium mobilization. J Immunol. 179(9): 6305-10.
  • Steinberg MW, et al. (2008) A crucial role for HVEM and BTLA in preventing intestinal inflammation. J Exp Med. 205(6): 1463-76.
  • Pasero C, et al. (2009) A role for HVEM, but not lymphotoxin-beta receptor, in LIGHT-induced tumor cell death and chemokine production. Eur J Immunol. 39(9): 2502-14.
  • Cheung TC. Modulation of T cell proliferation through the LIGHT-HVEM-BTLA cosignaling pathway. Recent Pat DNA Gene Seq. 3(3): 177-82.
  • Contact Us
    • Mouse HVEM / TNFRSF14 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.