Hsp27 / HSPB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10351-M-F

This product is not available, please contact order@sinobiological.com for relevant product if required.

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Hsp27 / HSPB1 Reagents
CRO Services

All Hsp27 / HSPB1 Reagents
Hsp27 / HSPB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
618 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human heat shock 27kDa protein 1 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
HindIII + XhoI (5.4kb + 0.67kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Hsp27 / HSPB1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Hsp27 / HSPB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CMT2F cDNA ORF Clone, Human;HEL-S-102 cDNA ORF Clone, Human;HMN2B cDNA ORF Clone, Human;HS.76067 cDNA ORF Clone, Human;Hsp25 cDNA ORF Clone, Human;HSP27 cDNA ORF Clone, Human;HSP28 cDNA ORF Clone, Human;SRP27 cDNA ORF Clone, Human
Hsp27 / HSPB1 Background Information
Full Name
heat shock 27kDa protein 1

Hsp27 / HSPB1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Hsp27 / HSPB1 cDNA ORF Clone in Cloning Vector, Mouse MG53720-U
Hsp27 / HSPB1 cDNA ORF Clone, Mouse, untagged MG53720-UT
Hsp27 / HSPB1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53720-ACGLN
Hsp27 / HSPB1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53720-ACG
Hsp27 / HSPB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53720-ANG
Hsp27 / HSPB1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53720-ACR
Hsp27 / HSPB1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53720-ANR
Hsp27 / HSPB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53720-CF
Hsp27 / HSPB1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53720-NF
Hsp27 / HSPB1 cDNA ORF Clone, Mouse, C-His tag MG53720-CH
Hsp27 / HSPB1 cDNA ORF Clone, Mouse, N-His tag MG53720-NH
Hsp27 / HSPB1 cDNA ORF Clone, Mouse, C-HA tag MG53720-CY
Hsp27 / HSPB1 cDNA ORF Clone, Mouse, N-HA tag MG53720-NY
Hsp27 / HSPB1 cDNA ORF Clone, Mouse, C-Myc tag MG53720-CM
Hsp27 / HSPB1 cDNA ORF Clone, Mouse, N-Myc tag MG53720-NM

Hsp27 / HSPB1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Hsp27 / HSPB1 cDNA ORF Clone in Cloning Vector, Human HG10351-M
Hsp27 / HSPB1 cDNA ORF Clone, Human, untagged HG10351-UT
Hsp27 / HSPB1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10351-ACG
Hsp27 / HSPB1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10351-ACGLN
Hsp27 / HSPB1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10351-ANG
Hsp27 / HSPB1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10351-ACR
Hsp27 / HSPB1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10351-ANR
Hsp27 / HSPB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10351-CF
Hsp27 / HSPB1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10351-NF
Hsp27 / HSPB1 cDNA ORF Clone, Human, C-His tag HG10351-CH
Hsp27 / HSPB1 cDNA ORF Clone, Human, N-His tag HG10351-NH
Hsp27 / HSPB1 cDNA ORF Clone, Human, C-HA tag HG10351-CY
Hsp27 / HSPB1 cDNA ORF Clone, Human, N-HA tag HG10351-NY
Hsp27 / HSPB1 cDNA ORF Clone, Human, C-Myc tag HG10351-CM
Hsp27 / HSPB1 cDNA ORF Clone, Human, N-Myc tag HG10351-NM
Hsp27 / HSPB1 qPCR Primer Pairs, Human HP100388
info info
添加购物车成功! 添加购物车失败!