Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HNF4AcDNA Clone Product Information
Gene Bank Ref.ID:
cDNA Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping Carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Images
  • Human HNF4A transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"