HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, N-His tag

Cat: VG40261-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HIV GP125 Reagents
CRO Services
Product recommended

All HIV GP125 Reagents
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, N-His tag General Information
Gene
Species
HIV
NCBI Ref Seq
RefSeq ORF Size
1515 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 (env 6682-8196bp) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HIV GP125 Background Information

HIV GP125 cDNA ORF Clone, HIV, Related Products

Product Name Catalog#(PDF)
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid (Codon Optimized) VG40261-G
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 natural ORF mammalian expression plasmid VG40261-UT
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40261-ACGLN
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-GFPSpark tag VG40261-ACG
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40261-ACR
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-Flag tag VG40261-CF
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, N-Flag tag VG40261-NF
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-His tag VG40261-CH
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-HA tag VG40261-CY
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, N-HA tag VG40261-NY
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, C-Myc tag VG40261-CM
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) GP125 ORF mammalian expression plasmid, N-Myc tag VG40261-NM
info info
添加购物车成功! 添加购物车失败!