Quick Order

HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
HIV HIV-gag cDNA Clone Product Information
NCBI RefSeq:AB731740.1
RefSeq ORF Size:1566bp
cDNA Description:Full length Clone DNA of HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag with C terminal HA tag.
Gene Synonym:HIV-gag
Species:HIV
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-HA tag on other vectors
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-GFPSpark tagVG40260-ACG$345
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40260-ACR$345
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-GFPSpark tagVG40260-ANG$345
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40260-ANR$345
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-Flag tagVG40260-CF$315
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-His tagVG40260-CH$315
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-Myc tagVG40260-CM$315
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-HA tagVG40260-CY$315
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid (Codon Optimized)VG40260-G$115
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-Flag tagVG40260-NF$315
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-His tagVG40260-NH$315
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-Myc tagVG40260-NM$315
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-HA tagVG40260-NY$315
HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag natural ORF mammalian expression plasmidVG40260-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40260-CY
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"