Quick Order

HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    HIV HIV-gag cDNA Clone Product Information
    NCBI RefSeq:U52953.1
    RefSeq ORF Size:1491bp
    cDNA Description:Full length Clone DNA of HIV-1 (group M, subtype C, strain 92BR025.8) gag with N terminal His tag.
    Gene Synonym:HIV-gag
    Species:HIV
    Vector:pCMV3-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-His tag on other vectors
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-GFPSpark tagVG40250-ACG$325
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40250-ACR$325
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-GFPSpark tagVG40250-ANG$325
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40250-ANR$325
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-Flag tagVG40250-CF$295
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-His tagVG40250-CH$295
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-Myc tagVG40250-CM$295
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-HA tagVG40250-CY$295
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid (Codon Optimized)VG40250-G$95
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-Flag tagVG40250-NF$295
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-His tagVG40250-NH$295
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-Myc tagVG40250-NM$295
    HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-HA tagVG40250-NY$295
    HIV-1 (group M, subtype C, strain 92BR025.8) gag natural ORF mammalian expression plasmidVG40250-UT$295
     Learn more about expression Vectors
    Product nameProduct name
    Size / Price
    Catalog: VG40250-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"