After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
HIV HIV-gag cDNA Clone Product Information
NCBI RefSeq:U52953.1
RefSeq ORF Size:1491bp
cDNA Description:Full length Clone DNA of HIV-1 (group M, subtype C, strain 92BR025.8) gag with N terminal His tag.
Gene Synonym:HIV-gag
Species:HIV
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-His tag on other vectors
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-GFPSpark tagVG40250-ACG$325
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40250-ACR$325
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-GFPSpark tagVG40250-ANG$325
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40250-ANR$325
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-Flag tagVG40250-CF$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-His tagVG40250-CH$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-Myc tagVG40250-CM$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-HA tagVG40250-CY$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid (Codon Optimized)VG40250-G$95
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-Flag tagVG40250-NF$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-His tagVG40250-NH$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-Myc tagVG40250-NM$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-HA tagVG40250-NY$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag natural ORF mammalian expression plasmidVG40250-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40250-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"