Integrin beta 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10587-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Integrin beta 1 Reagents
CRO Services
Product recommended

All Integrin beta 1 Reagents
Integrin beta 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2397 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 498T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12), transcript variant 1A with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI + XbaI (6kb + 2.44kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Integrin beta 1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Integrin beta 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human aFGF/FGF1 Gene Plasmid Map 5637
Human ITGB1 / Integrin beta-1 / CD29 Gene Expression validated Image 16490
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Integrin beta 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CD29 cDNA ORF Clone, Human;FNRB cDNA ORF Clone, Human;GPIIA cDNA ORF Clone, Human;MDF2 cDNA ORF Clone, Human;MSK12 cDNA ORF Clone, Human;VLA-BETA cDNA ORF Clone, Human;VLAB cDNA ORF Clone, Human
Integrin beta 1 Background Information
Full Name
integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12)
Research Areas

Integrin beta 1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Integrin beta 1 cDNA ORF Clone in Cloning Vector, Rhesus CG90179-G
Integrin beta 1 cDNA ORF Clone, Rhesus, untagged CG90179-UT
Integrin beta 1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90179-ACG
Integrin beta 1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90179-ACGLN
Integrin beta 1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90179-ACR
Integrin beta 1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90179-CF
Integrin beta 1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90179-NF
Integrin beta 1 cDNA ORF Clone, Rhesus, C-His tag CG90179-CH
Integrin beta 1 cDNA ORF Clone, Rhesus, N-His tag CG90179-NH
Integrin beta 1 cDNA ORF Clone, Rhesus, C-HA tag CG90179-CY
Integrin beta 1 cDNA ORF Clone, Rhesus, N-HA tag CG90179-NY
Integrin beta 1 cDNA ORF Clone, Rhesus, C-Myc tag CG90179-CM
Integrin beta 1 cDNA ORF Clone, Rhesus, N-Myc tag CG90179-NM

Integrin beta 1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
Integrin beta 1 cDNA ORF Clone in Cloning Vector, Canine DG70111-G

Integrin beta 1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Integrin beta 1 cDNA ORF Clone in Cloning Vector, Rat RG80290-G
Integrin beta 1 cDNA ORF Clone, Rat, untagged RG80290-UT
Integrin beta 1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80290-ACG
Integrin beta 1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80290-ACGLN
Integrin beta 1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80290-ACR
Integrin beta 1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80290-CF
Integrin beta 1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80290-NF
Integrin beta 1 cDNA ORF Clone, Rat, C-His tag RG80290-CH
Integrin beta 1 cDNA ORF Clone, Rat, N-His tag RG80290-NH
Integrin beta 1 cDNA ORF Clone, Rat, C-HA tag RG80290-CY
Integrin beta 1 cDNA ORF Clone, Rat, N-HA tag RG80290-NY
Integrin beta 1 cDNA ORF Clone, Rat, C-Myc tag RG80290-CM
Integrin beta 1 cDNA ORF Clone, Rat, N-Myc tag RG80290-NM
Integrin beta 1 qPCR Primer Pairs, Rat RP300267

Integrin beta 1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Integrin beta 1 cDNA ORF Clone in Cloning Vector, Mouse MG50054-M
Integrin beta 1 cDNA ORF Clone, Mouse, untagged MG50054-UT
Integrin beta 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50054-ACG
Integrin beta 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50054-ACGLN
Integrin beta 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50054-ACR
Integrin beta 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50054-CF
Integrin beta 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50054-NF
Integrin beta 1 cDNA ORF Clone, Mouse, C-His tag MG50054-CH
Integrin beta 1 cDNA ORF Clone, Mouse, N-His tag MG50054-NH
Integrin beta 1 cDNA ORF Clone, Mouse, C-HA tag MG50054-CY
Integrin beta 1 cDNA ORF Clone, Mouse, N-HA tag MG50054-NY
Integrin beta 1 cDNA ORF Clone, Mouse, C-Myc tag MG50054-CM
Integrin beta 1 cDNA ORF Clone, Mouse, N-Myc tag MG50054-NM
Integrin beta 1 qPCR Primer Pairs, Mouse MP200054

Integrin beta 1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Integrin beta 1 cDNA ORF Clone in Cloning Vector, Human HG10587-M
Integrin beta 1 cDNA ORF Clone, Human, untagged HG10587-UT
Integrin beta 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10587-ACG
Integrin beta 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10587-ACGLN
Integrin beta 1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10587-ANG
Integrin beta 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10587-ACR
Integrin beta 1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10587-ANR
Integrin beta 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10587-CF
Integrin beta 1 cDNA ORF Clone, Human, C-His tag HG10587-CH
Integrin beta 1 cDNA ORF Clone, Human, N-His tag HG10587-NH
Integrin beta 1 cDNA ORF Clone, Human, C-HA tag HG10587-CY
Integrin beta 1 cDNA ORF Clone, Human, N-HA tag HG10587-NY
Integrin beta 1 cDNA ORF Clone, Human, C-Myc tag HG10587-CM
Integrin beta 1 cDNA ORF Clone, Human, N-Myc tag HG10587-NM
Integrin beta 1 qPCR Primer Pairs, Human HP100590
info info
添加购物车成功! 添加购物车失败!