Text Size:AAA

Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human ITGB1 cDNA Clone Product Information
    NCBI RefSeq:NM_002211.3
    RefSeq ORF Size:2397bp
    cDNA Description:Full length Clone DNA of Human integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12), transcript variant 1A with N terminal His tag.
    Gene Synonym:CD29, FNRB, MDF2, VLAB, GPIIA, MSK12, VLA-BETA
    Species:Human
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7( 5' TAATACGACTCACTATAGGG 3' )
    BGH( 5' TAGAAGGCACAGTCGAGG 3' )
    ( We provide with ITGB1 qPCR primers for gene expression analysis, HP100590 )
    Promoter:Enhanced CMV cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-His tag on other vectors
    Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10587-ACG$245
    Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10587-ACR$245
    Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10587-ANG$245
    Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10587-ANR$245
    Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-Flag tagHG10587-CF$215
    Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-His tagHG10587-CH$215
    Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-Myc tagHG10587-CM$215
    Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-HA tagHG10587-CY$215
    Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone in cloning vectorHG10587-M$75
    Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-Flag tagHG10587-NF$215
    Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-His tagHG10587-NH$215
    Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-Myc tagHG10587-NM$215
    Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-HA tagHG10587-NY$215
    Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmidHG10587-UT$215
     Learn more about expression Vectors
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"