Quick Order

Text Size:AAA

Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human ITGB1 cDNA Clone Product Information
NCBI RefSeq:NM_002211.3
RefSeq ORF Size:2397bp
cDNA Description:Full length Clone DNA of Homo sapiens integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12), transcript variant 1A with N terminal Flag tag.
Gene Synonym:CD29, FNRB, MDF2, VLAB, GPIIA, MSK12, VLA-BETA
Species:Human
Vector:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-ITGB1
Restriction Site:KpnI + XbaI (6kb + 2.44kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 498T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ITGB1 Gene Plasmid Map
HHuman Integrin beta1 transcript variant 1A natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-Flag tag on other vectors
Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10587-ACG$245
Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10587-ACR$245
Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10587-ANG$245
Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10587-ANR$245
Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-Flag tagHG10587-CF$215
Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-His tagHG10587-CH$215
Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-Myc tagHG10587-CM$215
Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-HA tagHG10587-CY$215
Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone in cloning vectorHG10587-M$75
Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-Flag tagHG10587-NF$215
Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-His tagHG10587-NH$215
Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-Myc tagHG10587-NM$215
Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-HA tagHG10587-NY$215
Human ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmidHG10587-UT$215
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: HG10587-NF
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • HHuman Integrin beta1 transcript variant 1A natural ORF mammalian expression plasmid, N-Flag tag
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"