Quick Order

Influenza A H10N8 (A/duck/Guangdong/E1/2012) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized)

  • Influenza A H10N8 (A/duck/Guangdong/E1/2012) Nucleoprotein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
H10N8 NP cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:1497bp
cDNA Description:Full length Clone DNA of Influenza A H10N8 (A/duck/Guangdong/E1/2012) Nucleoprotein / NP DNA.
Gene Synonym:NP
Species:H10N8
Vector:pCMV/hygro
Plasmid:pCMV-H10N8-DG-12-NP
Restriction Site:KpnI + XbaI (5.5kb + 1.5kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AFJ19057.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H10N8 NP Gene Plasmid Map
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Nucleoprotein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"