Quick Order

Human LGALS8 transcript variant 1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human LGALS8 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
References
  • Levy Y, et al. (2003) Sustained induction of ERK, protein kinase B, and p70 S6 kinase regulates cell spreading and formation of F-actin microspikes upon ligation of integrins by galectin-8, a mammalian lectin. J Biol Chem. 278(16):14533-42.
  • Nishi N, et al. (2003) Galectin-8 modulates neutrophil function via interaction with integrin alphaM. Glycobiology. 13(11):755-63.
  • Bidon-Wagner N, et al. (2004) Human galectin-8 isoforms and cancer. Glycoconj J. 19(7-9):557-63.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"