LGALS3BP cDNA ORF Clone, Human, untagged

Cat: HG10300-M-N

NOT AVAILABLE

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LGALS3BP Reagents
CRO Services

All LGALS3BP Reagents
LGALS3BP cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1758 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human lectin, galactoside-binding, soluble, 3 binding protein DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
LGALS3BP cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LGALS3BP cDNA ORF Clone, Human, untagged Alternative Names
90K cDNA ORF Clone, Human;BTBD17B cDNA ORF Clone, Human;CyCAP cDNA ORF Clone, Human;gp90 cDNA ORF Clone, Human;M2BP cDNA ORF Clone, Human;MAC-2-BP cDNA ORF Clone, Human;TANGO10B cDNA ORF Clone, Human
LGALS3BP Background Information
Full Name
lectin, galactoside-binding, soluble, 3 binding protein

LGALS3BP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LGALS3BP cDNA ORF Clone in Cloning Vector, Mouse MG50614-M
LGALS3BP cDNA ORF Clone, Mouse, untagged MG50614-UT
LGALS3BP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50614-ACGLN
LGALS3BP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50614-ACG
LGALS3BP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50614-ACR
LGALS3BP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50614-CF
LGALS3BP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50614-NF
LGALS3BP cDNA ORF Clone, Mouse, C-His tag MG50614-CH
LGALS3BP cDNA ORF Clone, Mouse, N-His tag MG50614-NH
LGALS3BP cDNA ORF Clone, Mouse, C-HA tag MG50614-CY
LGALS3BP cDNA ORF Clone, Mouse, N-HA tag MG50614-NY
LGALS3BP cDNA ORF Clone, Mouse, C-Myc tag MG50614-CM
LGALS3BP cDNA ORF Clone, Mouse, N-Myc tag MG50614-NM
LGALS3BP qPCR Primer Pairs, Mouse MP200599

LGALS3BP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LGALS3BP cDNA ORF Clone in Cloning Vector, Human HG10300-M
LGALS3BP cDNA ORF Clone, Human, untagged HG10300-UT
LGALS3BP cDNA ORF Clone, Human, C-GFPSpark® tag HG10300-ACG
LGALS3BP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10300-ACGLN
LGALS3BP cDNA ORF Clone, Human, C-OFPSpark® tag HG10300-ACR
LGALS3BP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10300-CF
LGALS3BP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10300-NF
LGALS3BP cDNA ORF Clone, Human, C-His tag HG10300-CH
LGALS3BP cDNA ORF Clone, Human, N-His tag HG10300-NH
LGALS3BP cDNA ORF Clone, Human, C-HA tag HG10300-CY
LGALS3BP cDNA ORF Clone, Human, N-HA tag HG10300-NY
LGALS3BP cDNA ORF Clone, Human, C-Myc tag HG10300-CM
LGALS3BP cDNA ORF Clone, Human, N-Myc tag HG10300-NM
LGALS3BP qPCR Primer Pairs, Human HP100343
info info
添加购物车成功! 添加购物车失败!