Glypican 6/GPC6 cDNA ORF Clone, Human, untagged

Cat: HG10102-M-N
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Glypican 6/GPC6 Reagents
CRO Services

All Glypican 6/GPC6 Reagents
Glypican 6/GPC6 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1668 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for two point mutations 267 G/A and 684 C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human glypican 6.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI (5.5kb + 1.67kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Glypican 6/GPC6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Glypican 6/GPC6 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 7139
Glypican 6/GPC6 cDNA ORF Clone, Human, untagged Alternative Names
OMIMD1 cDNA ORF Clone, Human
Glypican 6/GPC6 Background Information
Full Name
glypican 6

Glypican 6/GPC6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Glypican 6/GPC6 cDNA ORF Clone in Cloning Vector, Mouse MG50742-M
Glypican 6/GPC6 cDNA ORF Clone, Mouse, untagged MG50742-UT
Glypican 6/GPC6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50742-ACG
Glypican 6/GPC6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50742-ACGLN
Glypican 6/GPC6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50742-ACR
Glypican 6/GPC6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50742-CF
Glypican 6/GPC6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50742-NF
Glypican 6/GPC6 cDNA ORF Clone, Mouse, C-His tag MG50742-CH
Glypican 6/GPC6 cDNA ORF Clone, Mouse, N-His tag MG50742-NH
Glypican 6/GPC6 cDNA ORF Clone, Mouse, C-HA tag MG50742-CY
Glypican 6/GPC6 cDNA ORF Clone, Mouse, N-HA tag MG50742-NY
Glypican 6/GPC6 cDNA ORF Clone, Mouse, C-Myc tag MG50742-CM
Glypican 6/GPC6 cDNA ORF Clone, Mouse, N-Myc tag MG50742-NM
Glypican 6/GPC6 qPCR Primer Pairs, Mouse MP200717

Glypican 6/GPC6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Glypican 6/GPC6 cDNA ORF Clone in Cloning Vector, Human HG10102-M
Glypican 6/GPC6 cDNA ORF Clone, Human, untagged HG10102-UT
Glypican 6/GPC6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10102-ACGLN
Glypican 6/GPC6 cDNA ORF Clone, Human, C-GFPSpark® tag HG10102-ACG
Glypican 6/GPC6 cDNA ORF Clone, Human, C-OFPSpark® tag HG10102-ACR
Glypican 6/GPC6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10102-CF
Glypican 6/GPC6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10102-NF
Glypican 6/GPC6 cDNA ORF Clone, Human, C-His tag HG10102-CH
Glypican 6/GPC6 cDNA ORF Clone, Human, N-His tag HG10102-NH
Glypican 6/GPC6 cDNA ORF Clone, Human, C-HA tag HG10102-CY
Glypican 6/GPC6 cDNA ORF Clone, Human, N-HA tag HG10102-NY
Glypican 6/GPC6 cDNA ORF Clone, Human, C-Myc tag HG10102-CM
Glypican 6/GPC6 cDNA ORF Clone, Human, N-Myc tag HG10102-NM
Glypican 6/GPC6 qPCR Primer Pairs, Human HP100182
info info
添加购物车成功! 添加购物车失败!