After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Glypican 6/GPC6 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human GPC6 cDNA Clone Product Information
NCBI RefSeq:NM_005708.3
RefSeq ORF Size:1668bp
cDNA Description:Full length Clone DNA of Homo sapiens glypican 6.
Gene Synonym:GPC6, MGC126288
Restriction Site:KpnI + XhoI (5.5kb + 1.67kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations 267 G/A and 684 C/T not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human GPC6 Gene Plasmid Map
Human GPC6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG10102-M-N
List Price: 
Price:      (You Save: )
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
  • Human GPC6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.