Quick Order

Human Glypican 5/GPC5 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human Glypican 5 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human Glypican 5 Gene Plasmid Map
Human GPC5 / glypican 5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Glypican-5 (GPC5), is a cell membrane protein which belongs to the glypican family. The glypicans compose a family of glycosylphosphatidylinositol-anchored heparan sulfate proteoglycans that may play a role in the control of cell division and growth regulation. So far, six members (Glypican-1/GPC1, Glypican-2/GPC2, Glypican-3/GPC3, Glypican-4/GPC4, Glypican-5/GPC5, Glypican-6/GPC6) of this family are known in vertebrates. In adult, Glypican-5 is primarily expressed in the brain. It is also detected in fetal brain, lung and liver. Glypican-5 enhances the intracellular signaling of FGF2 and HGF. It alters the cellular distribution of FGF2. The properties of Glypican-5 make it an attractive target for therapeutic intervention in rhabdomyosarcomas and other tumors that amplify and/or overexpress its gene. Glypican-5 is over-expressed in lymphoma cell lines that had shown amplification. It is a likely target for amplification, and that over-expression of GPC5 may contribute to development and/or progression of lymphomas and other tumors.

References
  • Yu W, et al. (2003) GPC5 is a possible target for the 13q31-q32 amplification detected in lymphoma cell lines. J Hum Genet. 48(6): 331-5.
  • Williamson D, et al. (2007) Role for amplification and expression of glypican-5 in rhabdomyosarcoma. Cancer Res. 67(1): 57-65.
  • Contact Us
    Images
    • Human GPC5 / glypican 5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"