Text Size:AAA

Human GNB2L1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GNB2L1cDNA Clone Product Information
Gene Bank Ref.ID:NM_006098.4
cDNA Size:954
cDNA Description:ORF Clone of Homo sapiens guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 DNA.
Gene Synonym:H12.3, HLC-7, PIG21, RACK1, Gnb2-rs1
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Human GNB2L1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name

RACK1 (guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1), also known as GNB2L1, contains 7 WD repeats and belongs to the WD repeat G protein beta family. In the liver, RACK1 is expressed at higher levels in activated hepatic stellate cells than in hepatocytes or Kupffer cells. It is up-regulated in hepatocellular carcinomas and in the adjacent non-tumor liver tissue. RACK1 is involved in the recruitment, assembly and/or regulation of a variety of signaling molecules. It interacts with a wide variety of proteins and plays a role in many cellular processes. GNB2L1 binds to and stabilizes activated protein kinase C (PKC), increasing PKC-mediated phosphorylation. RACK1 may recruit activated PKC to the ribosome, leading to phosphorylation of EIF6. It inhibits the activity of SRC kinases including SRC, LCK and YES1. RACK1 also inhibits cell growth by prolonging the G0/G1 phase of the cell cycle. It enhances phosphorylation of BMAL1 by PRKCA and inhibits transcriptional activity of the BMAL1-CLOCK heterodimer.

  • Jannot G, et al.. (2011) The ribosomal protein RACK1 is required for microRNA function in both C. elegans and humans. EMBO Rep. 12(6):581-6.
  • Wang F, et al. (2011) RACK1 regulates VEGF/Flt1-mediated cell migration via activation of a PI3K/Akt pathway. J Biol Chem. 286(11):9097-106.
  • Cao XX, et al. (2011) RACK1 promotes breast carcinoma migration/metastasis via activation of the RhoA/Rho kinase pathway. Breast Cancer Res Treat. 126(3):555-63.
  • Myklebust LM, et al. (2011) Receptor for activated protein C kinase 1 (RACK1) is overexpressed in papillary thyroid carcinoma. Thyroid. 21(11):1217-25.
  • Catalog:HG12498-G-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human GNB2L1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged