G-CSF cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10006-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All G-CSF Reagents
CRO Services

All G-CSF Reagents
G-CSF cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
624 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human colony stimulating factor 3 (granulocyte), transcript variant 1 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI (5.5kb + 0.65kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
G-CSF cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

G-CSF cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human G-CSF/CSF3 Gene Expression validated Image 2377
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Human G-CSF/CSF3 Gene Plasmid Map 7153
G-CSF cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
C17orf33 cDNA ORF Clone, Human;C17orf33OS cDNA ORF Clone, Human;CSF3OS cDNA ORF Clone, Human;G-CSF cDNA ORF Clone, Human;GCSF cDNA ORF Clone, Human
G-CSF Background Information

Granulocyte-colony stimulating factor (G-CSF) is a growth factor and an essential cytokine belonging to the CSF family of hormone-like glycoproteins. It is produced by numerous cell types including immune and endothelial cells. G-CSF binding to its receptor G-CSF-R which belongs to the cytokine receptor type I family depends on the interaction of alpha-helical motifs of the former and two fibronectin type III as well as an immunoglobulin-like domain of the latter. Recent animal studies have also revealed that G-CSF activates multiple signaling pathways, such as Akt and also the Janus family kinase-2 and signal transducer and activation of transcription-3 (Jak2-STAT3) pathway, thereby promoting survival, proliferation, differentiation and mobilisation of haematopoietic stem and progenitor cells. G-CSF is a cytokine that have been demonstrated to improve cardiac function and perfusion in myocardial infarction. And it was initially evaluated as a stem cell mobilizer and erythropoietin as a cytoprotective agent. G-CSF prevents left ventricular remodeling after myocardial infarction by decreasing cardiomyocyte death and by increasing the number of blood vessels, suggesting the importance of direct actions of G-CSF on the myocardium rather than through mobilization and differentiation of stem cells. Accordingly, recombinant human (rh)G-CSF has been extensively used in clinical haematology and oncology to enable bone marrow transplantation or to treat chemotherapy-associated neutropenia. In preclinical study, G-CSF improved cardiac function and perfusion by angiomyogenesis and protection of cardiomyocytes in myocardial infarction.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
colony stimulating factor 3 (granulocyte)
References
  • Takano H, et al. (2007) G-CSF therapy for acute myocardial infarction. Trends Pharmacol Sci. 28(10): 512-7.
  • Klocke R, et al. (2008) Granulocyte colony-stimulating factor (G-CSF) for cardio- and cerebrovascular regenerative applications. Curr Med Chem. 15(10): 968-77.
  • Kang HJ, et al. (2008) G-CSF- and erythropoietin-based cell therapy: a promising strategy for angiomyogenesis in myocardial infarction. Expert Rev Cardiovasc Ther. 6(5): 703-13.
  • Beekman R, et al. (2010) G-CSF and its receptor in myeloid malignancy. Blood. 115(25): 5131-6.
  • G-CSF cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    G-CSF cDNA ORF Clone in Cloning Vector, Human HG10006-M
    G-CSF cDNA ORF Clone in Cloning Vector, Human HG10007-M
    G-CSF cDNA ORF Clone, Human, untagged HG10007-UT
    G-CSF cDNA ORF Clone, Human, untagged HG10006-UT
    G-CSF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10006-ACGLN
    G-CSF cDNA ORF Clone, Human, C-GFPSpark® tag HG10006-ACG
    G-CSF cDNA ORF Clone, Human, C-GFPSpark® tag HG10007-ACG
    G-CSF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10007-ACGLN
    G-CSF cDNA ORF Clone, Human, C-OFPSpark® tag HG10006-ACR
    G-CSF cDNA ORF Clone, Human, C-OFPSpark® tag HG10007-ACR
    G-CSF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10007-CF
    G-CSF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10006-CF
    G-CSF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10007-NF
    G-CSF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10006-NF
    G-CSF cDNA ORF Clone, Human, C-His tag HG10006-CH
    G-CSF cDNA ORF Clone, Human, C-His tag HG10007-CH
    G-CSF cDNA ORF Clone, Human, N-His tag HG10006-NH
    G-CSF cDNA ORF Clone, Human, N-His tag HG10007-NH
    G-CSF cDNA ORF Clone, Human, C-HA tag HG10007-CY
    G-CSF cDNA ORF Clone, Human, C-HA tag HG10006-CY
    G-CSF cDNA ORF Clone, Human, N-HA tag HG10007-NY
    G-CSF cDNA ORF Clone, Human, N-HA tag HG10006-NY
    G-CSF cDNA ORF Clone, Human, C-Myc tag HG10007-CM
    G-CSF cDNA ORF Clone, Human, C-Myc tag HG10006-CM
    G-CSF cDNA ORF Clone, Human, N-Myc tag HG10007-NM
    G-CSF cDNA ORF Clone, Human, N-Myc tag HG10006-NM
    G-CSF qPCR Primer Pairs, Human HP100107
    info info
    添加购物车成功! 添加购物车失败!