After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human G-CSF/CSF3 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human G-CSF/CSF3 cDNA Clone Product Information
NCBI RefSeq:NM_000759.2
RefSeq ORF Size:624bp
cDNA Description:Full length Clone DNA of Homo sapiens colony stimulating factor 3 (granulocyte), transcript variant 1 with Flag tag.
Gene Synonym:CSF3, GCSF, G-CSF
Restriction Site:KpnI + XhoI (5.5kb + 0.65kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human G-CSF/CSF3 Gene Plasmid Map
Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Human G-CSF/CSF3 Gene Expression validated Image
Human GCSF transcript variant 1 natural ORF mammalian expression plasmid, Flag tag
[Click to enlarge image]
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Granulocyte-colony stimulating factor (G-CSF) is a growth factor and an essential cytokine belonging to the CSF family of hormone-like glycoproteins. It is produced by numerous cell types including immune and endothelial cells. G-CSF binding to its receptor G-CSF-R which belongs to the cytokine receptor type I family depends on the interaction of alpha-helical motifs of the former and two fibronectin type III as well as an immunoglobulin-like domain of the latter. Recent animal studies have also revealed that G-CSF activates multiple signaling pathways, such as Akt and also the Janus family kinase-2 and signal transducer and activation of transcription-3 (Jak2-STAT3) pathway, thereby promoting survival, proliferation, differentiation and mobilisation of haematopoietic stem and progenitor cells. G-CSF is a cytokine that have been demonstrated to improve cardiac function and perfusion in myocardial infarction. And it was initially evaluated as a stem cell mobilizer and erythropoietin as a cytoprotective agent. G-CSF prevents left ventricular remodeling after myocardial infarction by decreasing cardiomyocyte death and by increasing the number of blood vessels, suggesting the importance of direct actions of G-CSF on the myocardium rather than through mobilization and differentiation of stem cells. Accordingly, recombinant human (rh)G-CSF has been extensively used in clinical haematology and oncology to enable bone marrow transplantation or to treat chemotherapy-associated neutropenia. In preclinical study, G-CSF improved cardiac function and perfusion by angiomyogenesis and protection of cardiomyocytes in myocardial infarction.

  • Takano H, et al. (2007) G-CSF therapy for acute myocardial infarction. Trends Pharmacol Sci. 28(10): 512-7.
  • Klocke R, et al. (2008) Granulocyte colony-stimulating factor (G-CSF) for cardio- and cerebrovascular regenerative applications. Curr Med Chem. 15(10): 968-77.
  • Kang HJ, et al. (2008) G-CSF- and erythropoietin-based cell therapy: a promising strategy for angiomyogenesis in myocardial infarction. Expert Rev Cardiovasc Ther. 6(5): 703-13.
  • Beekman R, et al. (2010) G-CSF and its receptor in myeloid malignancy. Blood. 115(25): 5131-6.
  • Contact Us
    • Human GCSF transcript variant 1 natural ORF mammalian expression plasmid, Flag tag
    • Human GCSF transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.