GAPDH cDNA ORF Clone, Human, untagged

Cat: HG10094-M-N
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GAPDH Reagents
CRO Services

All GAPDH Reagents
GAPDH cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1008 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for two point mutations: 381 T/C and 885 T/C, none of which causes the encoded amino acid variation yet.
Description
Full length Clone DNA of Human glyceraldehyde-3-phosphate dehydrogenase DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
GAPDH cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GAPDH cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 7139
GAPDH cDNA ORF Clone, Human, untagged Alternative Names
G3PD cDNA ORF Clone, Human;GAPD cDNA ORF Clone, Human;HEL-S-162eP cDNA ORF Clone, Human
GAPDH Background Information

Glyceraldehyde 3-phosphate dehydrogenase (GAPDH or G3PDH) is an enzyme of about 37kDa that is consisdered as a cellular enzyme involved in glycolysis. It catelyzes the sixth step of glycolysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a pleiotropic enzyme that is overexpressed in apoptosis and in several human chronic pathologies. Its role as a mediator for cell death has also been highlighted. A recent report suggests that GAPDH may be genetically associated with late-onset of Alzheimer's disease. Besides, deprenyl, which has originally been used as a monoamine oxidase inhibitor for Parkinson's disease, binds to GAPDH and displays neuroprotective actions.

Full Name
glyceraldehyde-3-phosphate dehydrogenase
References
  • Hara MR, et al. (2006) Neuroprotection by pharmacologic blockade of the GAPDH death cascade. PNA. 103 (10): 3887-9.
  • Hara MR, et al. (2006) GAPDH as a sensor of NO stress.Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 1762 (5): 502-9.
  • Tarze A, et al. (2007) GAPDH, a novel regulator of the pro-apoptotic mitochondrial membrane permeabilizationGAPDH and apoptosis. Oncogene. 26: 2606-20.
  • Yi MK, et al. (2000) Functional Significance of the Interaction of Hepatitis A Virus RNA with Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH): Opposing Effects of GAPDH and Polypyrimidine Tract Binding Protein on Internal Ribosome Entry Site Function. Journal of Virology. 74 (14) : 6459-68.
  • GAPDH cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    GAPDH cDNA ORF Clone in Cloning Vector, Canine DG70183-U
    GAPDH cDNA ORF Clone, Canine, untagged DG70183-UT
    GAPDH Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70183-ACGLN
    GAPDH cDNA ORF Clone, Canine, C-GFPSpark® tag DG70183-ACG
    GAPDH cDNA ORF Clone, Canine, N-GFPSpark® tag DG70183-ANG
    GAPDH cDNA ORF Clone, Canine, C-OFPSpark® tag DG70183-ACR
    GAPDH cDNA ORF Clone, Canine, N-OFPSpark® tag DG70183-ANR
    GAPDH cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70183-CF
    GAPDH cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70183-NF
    GAPDH cDNA ORF Clone, Canine, C-His tag DG70183-CH
    GAPDH cDNA ORF Clone, Canine, N-His tag DG70183-NH
    GAPDH cDNA ORF Clone, Canine, C-HA tag DG70183-CY
    GAPDH cDNA ORF Clone, Canine, N-HA tag DG70183-NY
    GAPDH cDNA ORF Clone, Canine, C-Myc tag DG70183-CM
    GAPDH cDNA ORF Clone, Canine, N-Myc tag DG70183-NM

    GAPDH cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    GAPDH cDNA ORF Clone in Cloning Vector, Cynomolgus CG90448-G
    GAPDH cDNA ORF Clone, Cynomolgus, untagged CG90448-UT
    GAPDH Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90448-ACGLN
    GAPDH cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90448-ACG
    GAPDH cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90448-ANG
    GAPDH cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90448-ACR
    GAPDH cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90448-ANR
    GAPDH cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90448-CF
    GAPDH cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90448-NF
    GAPDH cDNA ORF Clone, Cynomolgus, C-His tag CG90448-CH
    GAPDH cDNA ORF Clone, Cynomolgus, N-His tag CG90448-NH
    GAPDH cDNA ORF Clone, Cynomolgus, C-HA tag CG90448-CY
    GAPDH cDNA ORF Clone, Cynomolgus, N-HA tag CG90448-NY
    GAPDH cDNA ORF Clone, Cynomolgus, C-Myc tag CG90448-CM
    GAPDH cDNA ORF Clone, Cynomolgus, N-Myc tag CG90448-NM

    GAPDH cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    GAPDH cDNA ORF Clone in Cloning Vector, Rabbit TG65041-G
    GAPDH cDNA ORF Clone, Rabbit, untagged TG65041-UT
    GAPDH Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65041-ACGLN
    GAPDH cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65041-ACG
    GAPDH cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65041-ANG
    GAPDH cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65041-ACR
    GAPDH cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65041-ANR
    GAPDH cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65041-CF
    GAPDH cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65041-NF
    GAPDH cDNA ORF Clone, Rabbit, C-His tag TG65041-CH
    GAPDH cDNA ORF Clone, Rabbit, N-His tag TG65041-NH
    GAPDH cDNA ORF Clone, Rabbit, C-HA tag TG65041-CY
    GAPDH cDNA ORF Clone, Rabbit, N-HA tag TG65041-NY
    GAPDH cDNA ORF Clone, Rabbit, C-Myc tag TG65041-CM
    GAPDH cDNA ORF Clone, Rabbit, N-Myc tag TG65041-NM

    GAPDH cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    GAPDH cDNA ORF Clone in Cloning Vector, Rat RG80680-U
    GAPDH cDNA ORF Clone, Rat, untagged RG80680-UT
    GAPDH Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80680-ACGLN
    GAPDH cDNA ORF Clone, Rat, C-GFPSpark® tag RG80680-ACG
    GAPDH cDNA ORF Clone, Rat, N-GFPSpark® tag RG80680-ANG
    GAPDH cDNA ORF Clone, Rat, C-OFPSpark® tag RG80680-ACR
    GAPDH cDNA ORF Clone, Rat, N-OFPSpark® tag RG80680-ANR
    GAPDH cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80680-CF
    GAPDH cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80680-NF
    GAPDH cDNA ORF Clone, Rat, C-His tag RG80680-CH
    GAPDH cDNA ORF Clone, Rat, N-His tag RG80680-NH
    GAPDH cDNA ORF Clone, Rat, C-HA tag RG80680-CY
    GAPDH cDNA ORF Clone, Rat, N-HA tag RG80680-NY
    GAPDH cDNA ORF Clone, Rat, C-Myc tag RG80680-CM
    GAPDH cDNA ORF Clone, Rat, N-Myc tag RG80680-NM
    GAPDH qPCR Primer Pairs, Rat RP300644

    GAPDH cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GAPDH cDNA ORF Clone in Cloning Vector, Mouse MG50545-M
    GAPDH cDNA ORF Clone in Cloning Vector, Mouse MG51221-U
    GAPDH cDNA ORF Clone, Mouse, untagged MG51221-UT
    GAPDH cDNA ORF Clone, Mouse, untagged MG50545-UT
    GAPDH cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50545-ACG
    GAPDH Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51221-ACGLN
    GAPDH Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50545-ACGLN
    GAPDH cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51221-ACG
    GAPDH cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50545-ANG
    GAPDH cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51221-ANG
    GAPDH cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50545-ACR
    GAPDH cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51221-ACR
    GAPDH cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50545-ANR
    GAPDH cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51221-ANR
    GAPDH cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51221-CF
    GAPDH cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50545-CF
    GAPDH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50545-NF
    GAPDH cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51221-NF
    GAPDH cDNA ORF Clone, Mouse, C-His tag MG51221-CH
    GAPDH cDNA ORF Clone, Mouse, C-His tag MG50545-CH
    GAPDH cDNA ORF Clone, Mouse, N-His tag MG51221-NH
    GAPDH cDNA ORF Clone, Mouse, N-His tag MG50545-NH
    GAPDH cDNA ORF Clone, Mouse, C-HA tag MG51221-CY
    GAPDH cDNA ORF Clone, Mouse, C-HA tag MG50545-CY
    GAPDH cDNA ORF Clone, Mouse, N-HA tag MG51221-NY
    GAPDH cDNA ORF Clone, Mouse, N-HA tag MG50545-NY
    GAPDH cDNA ORF Clone, Mouse, C-Myc tag MG51221-CM
    GAPDH cDNA ORF Clone, Mouse, C-Myc tag MG50545-CM
    GAPDH cDNA ORF Clone, Mouse, N-Myc tag MG51221-NM
    GAPDH cDNA ORF Clone, Mouse, N-Myc tag MG50545-NM
    GAPDH qPCR Primer Pairs, Mouse MP200537

    GAPDH cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GAPDH cDNA ORF Clone in Cloning Vector, Human HG10094-G
    GAPDH cDNA ORF Clone, Human, untagged HG10094-UT
    GAPDH cDNA ORF Clone, Human, C-GFPSpark® tag HG10094-ACG
    GAPDH Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10094-ACGLN
    GAPDH cDNA ORF Clone, Human, N-GFPSpark® tag HG10094-ANG
    GAPDH cDNA ORF Clone, Human, C-OFPSpark® tag HG10094-ACR
    GAPDH cDNA ORF Clone, Human, N-OFPSpark® tag HG10094-ANR
    GAPDH cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10094-CF
    GAPDH cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10094-NF
    GAPDH cDNA ORF Clone, Human, C-His tag HG10094-CH
    GAPDH cDNA ORF Clone, Human, N-His tag HG10094-NH
    GAPDH cDNA ORF Clone, Human, C-HA tag HG10094-CY
    GAPDH cDNA ORF Clone, Human, N-HA tag HG10094-NY
    GAPDH cDNA ORF Clone, Human, C-Myc tag HG10094-CM
    GAPDH cDNA ORF Clone, Human, N-Myc tag HG10094-NM
    GAPDH qPCR Primer Pairs, Human HP100003
    info info
    添加购物车成功! 添加购物车失败!