Quick Order

Human FetuinA / AHSG ORF mammalian expression plasmid, Flag tag

DatasheetReviewsRelated ProductsProtocols
Human AHSG cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Fetuin-A, also known as Alpha-2-HS-Glycoprotein (AHSG), belongs to the Fetuin family, is a plasma binding protein, and is more abundant in fetal than adult blood. It is involved in several functions, such as endocytosis, brain development and the formation of bone tissue. Fetuins are carrier proteins like albumin. Fetuin-A forms soluble complexes with calcium and phosphate and thus is a carrier of otherwise insoluble calcium phosphate. Thus Fetuin-A is a potent inhibitor of pathological calcification. The circulating levels of fetuin-A, a well-described inhibitor of calcification, regulate the cell-dependent process of osteogenesis. The low circulating fetuin-A levels are associated with a greater prevalence and/or severity of Vascular calcification (VC) and increased risk for all-cause and cardiovascular mortality. However, high circulating fetuin-A levels appear to induce insulin resistance and, in non-dialyzed subjects with diabetic nephropathy, are directly related to VC burden. The emerging role of fetuin-A deficiency as a risk factor in dialysis patients was documented in cross-sectional studies demonstrating a significant correlation with all-cause and cardiovascular mortality. Additionally, Human fetuin-A is a negative acute phase protein involved in inflammatory diseases, thus being a potential physiological regulator of meprin activity. Fetuin-A is a broad-range protease inhibitor. Fetuin-A and cystatin C as endogenous proteolytic regulators of meprin activity broadens our understanding of the proteolytic network in plasma.

  • Mehrotra R. (2007) Emerging role for fetuin-A as contributor to morbidity and mortality in chronic kidney disease. Kidney Int. 72(2): 137-40.
  • Westenfeld R, et al. (2007) Vascular calcification and fetuin-A deficiency in chronic kidney disease. Trends Cardiovasc Med. 17(4): 124-8.
  • Heiss A, et al. (2008). Hierarchical role of fetuin-A and acidic serum proteins in the formation and stabilization of calcium phosphate particles. J Biol Chem. 283 (21): 14815-25.
  • Jahnen-Dechent W, et al. (2008). Mineral chaperones: a role for fetuin-A and osteopontin in the inhibition and regression of pathologic calcification. J Mol Med. 86 (4): 379-89.
  • Hedrich J, et al. (2010) Fetuin-A and cystatin C are endogenous inhibitors of human meprin metalloproteases. Biochemistry. 49(39): 8599-607.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.