VPS29 cDNA ORF Clone, Ferret, C-His tag

Cat: FG60044-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VPS29 Reagents
CRO Services
Product recommended

All VPS29 Reagents
VPS29 cDNA ORF Clone, Ferret, C-His tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
549 bp
Description
Full length Clone DNA of Ferret vacuolar protein sorting 29 homolog (S. cerevisiae) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VPS29 Background Information
Full Name
vacuolar protein sorting 29 homolog (S. cerevisiae)

VPS29 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
VPS29 cDNA ORF Clone in Cloning Vector, Ferret FG60044-G
VPS29 cDNA ORF Clone, Ferret, untagged FG60044-UT
VPS29 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60044-ACG
VPS29 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60044-ACGLN
VPS29 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60044-ANG
VPS29 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60044-ACR
VPS29 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60044-ANR
VPS29 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60044-CF
VPS29 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60044-NF
VPS29 cDNA ORF Clone, Ferret, N-His tag FG60044-NH
VPS29 cDNA ORF Clone, Ferret, C-HA tag FG60044-CY
VPS29 cDNA ORF Clone, Ferret, N-HA tag FG60044-NY
VPS29 cDNA ORF Clone, Ferret, C-Myc tag FG60044-CM
VPS29 cDNA ORF Clone, Ferret, N-Myc tag FG60044-NM

VPS29 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
VPS29 cDNA ORF Clone in Cloning Vector, Rat RG81316-G
VPS29 cDNA ORF Clone, Rat, untagged RG81316-UT
VPS29 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81316-ACG
VPS29 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81316-ACGLN
VPS29 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81316-ANG
VPS29 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81316-ACR
VPS29 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81316-ANR
VPS29 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81316-CF
VPS29 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81316-NF
VPS29 cDNA ORF Clone, Rat, C-His tag RG81316-CH
VPS29 cDNA ORF Clone, Rat, N-His tag RG81316-NH
VPS29 cDNA ORF Clone, Rat, C-HA tag RG81316-CY
VPS29 cDNA ORF Clone, Rat, N-HA tag RG81316-NY
VPS29 cDNA ORF Clone, Rat, C-Myc tag RG81316-CM
VPS29 cDNA ORF Clone, Rat, N-Myc tag RG81316-NM
VPS29 qPCR Primer Pairs, Rat RP301272

VPS29 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VPS29 cDNA ORF Clone in Cloning Vector, Human HG16445-G
VPS29 cDNA ORF Clone, Human, untagged HG16445-UT
VPS29 cDNA ORF Clone, Human, C-GFPSpark® tag HG16445-ACG
VPS29 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16445-ACGLN
VPS29 cDNA ORF Clone, Human, N-GFPSpark® tag HG16445-ANG
VPS29 cDNA ORF Clone, Human, C-OFPSpark® tag HG16445-ACR
VPS29 cDNA ORF Clone, Human, N-OFPSpark® tag HG16445-ANR
VPS29 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16445-CF
VPS29 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16445-NF
VPS29 cDNA ORF Clone, Human, C-His tag HG16445-CH
VPS29 cDNA ORF Clone, Human, N-His tag HG16445-NH
VPS29 cDNA ORF Clone, Human, C-HA tag HG16445-CY
VPS29 cDNA ORF Clone, Human, N-HA tag HG16445-NY
VPS29 cDNA ORF Clone, Human, C-Myc tag HG16445-CM
VPS29 cDNA ORF Clone, Human, N-Myc tag HG16445-NM
VPS29 qPCR Primer Pairs, Human HP105191
info info
添加购物车成功! 添加购物车失败!