Quick Order

Ferret VCAM1/VCAM-1/CD106 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Ferret VCAM1 cDNA Clone Product Information
    NCBI RefSeq:XM_004812161.1
    RefSeq ORF Size:2220bp
    cDNA Description:Full length Clone DNA of Mustela putorius furo (sub-species: furo) vascular cell adhesion molecule 1 with N terminal HA tag.
    Gene Synonym:VCAM1
    Species:Ferret
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    Vascular cell adhesion molecule 1 (VCAM-1), also known as CD106, is a cell surface sialoglycoprotein belonging to the immunoglobulin superfamily. Two forms of VCAM-1 with either six or seven extracellular Ig-like domains are generated by alternative splicing, with the longer form predominant. VCAM-1 is an endothelial ligand for very late antigen-4 (VLA-4) and α4ß7 integrin expressed on leukocytes, and thus mediates leukocyte-endothelial cell adhesion and signal transduction. VCAM-1 expression is induced on endothelial cells during inflammatory bowel disease, atherosclerosis, allograft rejection, infection, and asthmatic responses. During these responses, VCAM-1 forms a scaffold for leukocyte migration. VCAM-1 also activates signals within endothelial cells resulting in the opening of an "endothelial cell gate" through which leukocytes migrate. VCAM-1 has been identified as a potential anti-inflammatory therapeutic target, the hypothesis being that reduced expression of VCAM-1 will slow the development of atherosclerosis. In addition, VCAM-1-activated signals in endothelial cells are regulated by cytokines indicating that it is important to consider both endothelial cell adhesion molecule expression and function during inflammatory processes.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Cook-Mills JM. (2002) VCAM-1 signals during lymphocyte migration: role of reactive oxygen species. Mol Immunol. 39(9): 499-508.
  • Preiss DJ, et al. (2007) Vascular cell adhesion molecule-1: a viable therapeutic target for atherosclerosis? Int J Clin Pract. 61(4): 697-701.
  • Size / Price
    Catalog: FG60134-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"