Ube2L6 cDNA ORF Clone, Ferret, C-His tag

Cat: FG60136-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Ube2L6 Reagents
CRO Services
Product recommended

All Ube2L6 Reagents
Ube2L6 cDNA ORF Clone, Ferret, C-His tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
462 bp
Description
Full length Clone DNA of Ferret ubiquitin-conjugating enzyme E2L 6 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ube2L6 Background Information

UBCH8, also known as UBE2L6, belongs to the ubiquitin-conjugating enzyme family. The family of ubiquitin-conjugating (E2) enzymes is characterized by the presence of a highly conserved ubiquitin-conjugating (UBC) domain. These domains accommodate the ATP-activated ubiquitin (Ub) or ubiquitin-like (UBL) protein via a covalently linked thioester onto its active-site residue. E2 enzymes act via selective protein-protein interactions with the E1 and E3 enzymes and connect activation to covalent modification. By doing so, E2s differentiate effects on downstream substrates, either with a single Ub/UBL molecule or as a chain. UBCH8 is highly similar in primary structure to the enzyme encoded by the UBE2L3 gene. It catalyzes the covalent attachment of ubiquitin or ISG15 to other proteins. UBCH8 functions in the E6/E6-AP-induced ubiquitination of p53/TP53 and promotes ubiquitination and subsequent proteasomal degradation of FLT3. At protein level, it is present in natural killer cells.

Full Name
ubiquitin-conjugating enzyme E2L 6
References
  • Moynihan TP, et al. (1999) The ubiquitin-conjugating enzymes UbcH7 and UbcH8 interact with RING finger/IBR motif-containing domains of HHARI and H7-AP1. J Biol Chem. 274(43):30963-8.
  • Ardley HC, et al. (2000) Genomic organization of the human ubiquitin-conjugating enzyme gene, UBE2L6 on chromosome 11q12. Cytogenet Cell Genet. 89(1-2):137-40.
  • Zhao C, et al. (2004) The UbcH8 ubiquitin E2 enzyme is also the E2 enzyme for ISG15, an IFN-alpha/beta-induced ubiquitin-like protein. Proc Natl Acad. 101(20):7578-82.
  • Tripathi MK, et al. (2005) Down-regulation of UCRP and UBE2L6 in BRCA2 knocked-down human breast cells. Biochem Biophys Res Commun. 328(1):43-8.
  • Ube2L6 cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    Ube2L6 cDNA ORF Clone in Cloning Vector, Ferret FG60136-G
    Ube2L6 cDNA ORF Clone, Ferret, untagged FG60136-UT
    Ube2L6 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60136-ACGLN
    Ube2L6 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60136-ACG
    Ube2L6 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60136-ANG
    Ube2L6 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60136-ACR
    Ube2L6 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60136-ANR
    Ube2L6 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60136-CF
    Ube2L6 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60136-NF
    Ube2L6 cDNA ORF Clone, Ferret, N-His tag FG60136-NH
    Ube2L6 cDNA ORF Clone, Ferret, C-HA tag FG60136-CY
    Ube2L6 cDNA ORF Clone, Ferret, N-HA tag FG60136-NY
    Ube2L6 cDNA ORF Clone, Ferret, C-Myc tag FG60136-CM
    Ube2L6 cDNA ORF Clone, Ferret, N-Myc tag FG60136-NM

    Ube2L6 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Ube2L6 cDNA ORF Clone in Cloning Vector, Mouse MG53602-U
    Ube2L6 cDNA ORF Clone, Mouse, untagged MG53602-UT
    Ube2L6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53602-ACGLN
    Ube2L6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53602-ACG
    Ube2L6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53602-ANG
    Ube2L6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53602-ACR
    Ube2L6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53602-ANR
    Ube2L6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53602-CF
    Ube2L6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53602-NF
    Ube2L6 cDNA ORF Clone, Mouse, C-His tag MG53602-CH
    Ube2L6 cDNA ORF Clone, Mouse, N-His tag MG53602-NH
    Ube2L6 cDNA ORF Clone, Mouse, C-HA tag MG53602-CY
    Ube2L6 cDNA ORF Clone, Mouse, N-HA tag MG53602-NY
    Ube2L6 cDNA ORF Clone, Mouse, C-Myc tag MG53602-CM
    Ube2L6 cDNA ORF Clone, Mouse, N-Myc tag MG53602-NM

    Ube2L6 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Ube2L6 cDNA ORF Clone in Cloning Vector, Human HG16791-U
    Ube2L6 cDNA ORF Clone, Human, untagged HG16791-UT
    Ube2L6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16791-ACGLN
    Ube2L6 cDNA ORF Clone, Human, C-GFPSpark® tag HG16791-ACG
    Ube2L6 cDNA ORF Clone, Human, N-GFPSpark® tag HG16791-ANG
    Ube2L6 cDNA ORF Clone, Human, C-OFPSpark® tag HG16791-ACR
    Ube2L6 cDNA ORF Clone, Human, N-OFPSpark® tag HG16791-ANR
    Ube2L6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16791-CF
    Ube2L6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16791-NF
    Ube2L6 cDNA ORF Clone, Human, C-His tag HG16791-CH
    Ube2L6 cDNA ORF Clone, Human, N-His tag HG16791-NH
    Ube2L6 cDNA ORF Clone, Human, C-HA tag HG16791-CY
    Ube2L6 cDNA ORF Clone, Human, N-HA tag HG16791-NY
    Ube2L6 cDNA ORF Clone, Human, C-Myc tag HG16791-CM
    Ube2L6 cDNA ORF Clone, Human, N-Myc tag HG16791-NM
    info info
    添加购物车成功! 添加购物车失败!