beta Tubulin cDNA ORF Clone, Ferret, untagged

Cat: FG60059-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All beta Tubulin Reagents
CRO Services
Product recommended

All beta Tubulin Reagents
beta Tubulin cDNA ORF Clone, Ferret, untagged General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1335 bp
Description
Full length Clone DNA of Ferret tubulin, beta class I.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

beta Tubulin Background Information
Full Name
tubulin beta class I

beta Tubulin cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
beta Tubulin cDNA ORF Clone in Cloning Vector, Ferret FG60059-G
beta Tubulin Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60059-ACGLN
beta Tubulin cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60059-ACG
beta Tubulin cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60059-ANG
beta Tubulin cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60059-ACR
beta Tubulin cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60059-ANR
beta Tubulin cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60059-CF
beta Tubulin cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60059-NF
beta Tubulin cDNA ORF Clone, Ferret, C-His tag FG60059-CH
beta Tubulin cDNA ORF Clone, Ferret, N-His tag FG60059-NH
beta Tubulin cDNA ORF Clone, Ferret, C-HA tag FG60059-CY
beta Tubulin cDNA ORF Clone, Ferret, N-HA tag FG60059-NY
beta Tubulin cDNA ORF Clone, Ferret, C-Myc tag FG60059-CM
beta Tubulin cDNA ORF Clone, Ferret, N-Myc tag FG60059-NM

beta Tubulin cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
beta Tubulin cDNA ORF Clone in Cloning Vector, Canine DG70160-U

beta Tubulin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
beta Tubulin cDNA ORF Clone in Cloning Vector, Human HG11626-G
beta Tubulin cDNA ORF Clone, Human, untagged HG11626-UT
beta Tubulin cDNA ORF Clone, Human, C-GFPSpark® tag HG11626-ACG
beta Tubulin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11626-ACGLN
beta Tubulin cDNA ORF Clone, Human, N-GFPSpark® tag HG11626-ANG
beta Tubulin cDNA ORF Clone, Human, C-OFPSpark® tag HG11626-ACR
beta Tubulin cDNA ORF Clone, Human, N-OFPSpark® tag HG11626-ANR
beta Tubulin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11626-CF
beta Tubulin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11626-NF
beta Tubulin cDNA ORF Clone, Human, C-His tag HG11626-CH
beta Tubulin cDNA ORF Clone, Human, N-His tag HG11626-NH
beta Tubulin cDNA ORF Clone, Human, C-HA tag HG11626-CY
beta Tubulin cDNA ORF Clone, Human, N-HA tag HG11626-NY
beta Tubulin cDNA ORF Clone, Human, C-Myc tag HG11626-CM
beta Tubulin cDNA ORF Clone, Human, N-Myc tag HG11626-NM
beta Tubulin qPCR Primer Pairs, Human HP101479
info info
添加购物车成功! 添加购物车失败!