Quick Order

Text Size:AAA

Ferret TREM-1/TREM1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Ferret TREM1 cDNA Clone Product Information
NCBI RefSeq:XM_004739942.1
RefSeq ORF Size:615bp
cDNA Description:Full length Clone DNA of Mustela putorius furo (sub-species: furo) triggering receptor expressed on myeloid cells 1 with C terminal His tag.
Gene Synonym:TREM1
Species:Ferret
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

TREM1 (triggering receptor expressed on myeloid cells) is a type I  transmembrane protein with a single Ig-like domain, and is selectively expressed on blood neutrophils and a subset of monocytes. As a member of the growing family of receptors related to NK cell receptors, TREM1 activates downstream signaling events with the help of an adapter protein called DAP12. Expression of TREM1 is up-regulated by bacterial LPS, a ligand for TLR4, as well as lipoteichoic acid. Although its natural ligand has not been identified, engagement of TREM1 with agonist mAbs triggers secretion of the proinflammatory cytokines TNF-α and IL-1β, as well as chemokines such as IL-8 and monocyte chemoattractant protein (MCP)-1. Intracellularly, TREM1 induces Ca2+ mobilization and tyrosine phosphorylation of extracellular signal-related kinase 1 (ERK1), ERK2 and phospholipase C-γ. In an animal model of LPS-induced septic shock, blockade of TREM1 signaling inhibited hyperresponsiveness and death. Thus, it has been demonstrated that TREM1 performs a critical function in immune responses involved in host defense against microbial challenges, and is suggested to be a potential therapeutic target for septic shock.

References
  • Bouchon, A. et al., 2000, J. Immunol. 164: 4991-4995.
  • Bouchon, A. et al., 2001, Nature. 410: 1103-1107.
  • Bleharski, J.R. et al., 2003, J. Immunol. 170: 3812-3818.
  • Size / Price
    Catalog: FG60048-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"