Quick Order

Ferret TREM-1/TREM1 Gene ORF cDNA clone expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Ferret TREM1 cDNA Clone Product Information
    NCBI RefSeq:XM_004739942.1
    RefSeq ORF Size:615bp
    cDNA Description:Full length Clone DNA of Mustela putorius furo (sub-species: furo) triggering receptor expressed on myeloid cells 1 with C terminal HA tag.
    Gene Synonym:TREM1
    Species:Ferret
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    TREM1 (triggering receptor expressed on myeloid cells) is a type I  transmembrane protein with a single Ig-like domain, and is selectively expressed on blood neutrophils and a subset of monocytes. As a member of the growing family of receptors related to NK cell receptors, TREM1 activates downstream signaling events with the help of an adapter protein called DAP12. Expression of TREM1 is up-regulated by bacterial LPS, a ligand for TLR4, as well as lipoteichoic acid. Although its natural ligand has not been identified, engagement of TREM1 with agonist mAbs triggers secretion of the proinflammatory cytokines TNF-α and IL-1β, as well as chemokines such as IL-8 and monocyte chemoattractant protein (MCP)-1. Intracellularly, TREM1 induces Ca2+ mobilization and tyrosine phosphorylation of extracellular signal-related kinase 1 (ERK1), ERK2 and phospholipase C-γ. In an animal model of LPS-induced septic shock, blockade of TREM1 signaling inhibited hyperresponsiveness and death. Thus, it has been demonstrated that TREM1 performs a critical function in immune responses involved in host defense against microbial challenges, and is suggested to be a potential therapeutic target for septic shock.

    References
  • Bouchon, A. et al., 2000, J. Immunol. 164: 4991-4995.
  • Bouchon, A. et al., 2001, Nature. 410: 1103-1107.
  • Bleharski, J.R. et al., 2003, J. Immunol. 170: 3812-3818.
  • Size / Price
    Catalog: FG60048-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"