TMX1 cDNA ORF Clone, Ferret, C-Myc tag

Cat: FG60107-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TMX1 Reagents
CRO Services
Product recommended

All TMX1 Reagents
TMX1 cDNA ORF Clone, Ferret, C-Myc tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
834 bp
Description
Full length Clone DNA of Ferret thioredoxin-related transmembrane protein 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMX1 Background Information
Full Name
thioredoxin-related transmembrane protein 1

TMX1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
TMX1 cDNA ORF Clone in Cloning Vector, Ferret FG60107-G
TMX1 cDNA ORF Clone, Ferret, untagged FG60107-UT
TMX1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60107-ACG
TMX1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60107-ACGLN
TMX1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60107-ACR
TMX1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60107-CF
TMX1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60107-NF
TMX1 cDNA ORF Clone, Ferret, C-His tag FG60107-CH
TMX1 cDNA ORF Clone, Ferret, N-His tag FG60107-NH
TMX1 cDNA ORF Clone, Ferret, C-HA tag FG60107-CY
TMX1 cDNA ORF Clone, Ferret, N-HA tag FG60107-NY
TMX1 cDNA ORF Clone, Ferret, N-Myc tag FG60107-NM

TMX1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TMX1 cDNA ORF Clone in Cloning Vector, Rat RG80923-U
TMX1 cDNA ORF Clone, Rat, untagged RG80923-UT
TMX1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80923-ACG
TMX1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80923-ACGLN
TMX1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80923-ACR
TMX1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80923-CF
TMX1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80923-NF
TMX1 cDNA ORF Clone, Rat, C-His tag RG80923-CH
TMX1 cDNA ORF Clone, Rat, N-His tag RG80923-NH
TMX1 cDNA ORF Clone, Rat, C-HA tag RG80923-CY
TMX1 cDNA ORF Clone, Rat, N-HA tag RG80923-NY
TMX1 cDNA ORF Clone, Rat, C-Myc tag RG80923-CM
TMX1 cDNA ORF Clone, Rat, N-Myc tag RG80923-NM
TMX1 qPCR Primer Pairs, Rat RP300887

TMX1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMX1 cDNA ORF Clone in Cloning Vector, Mouse MG5A6618-U
TMX1 cDNA ORF Clone, Mouse, untagged MG5A6618-UT
TMX1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6618-ACG
TMX1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6618-ACGLN
TMX1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A6618-ACR
TMX1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A6618-CF
TMX1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A6618-NF
TMX1 cDNA ORF Clone, Mouse, C-His tag MG5A6618-CH
TMX1 cDNA ORF Clone, Mouse, N-His tag MG5A6618-NH
TMX1 cDNA ORF Clone, Mouse, C-HA tag MG5A6618-CY
TMX1 cDNA ORF Clone, Mouse, N-HA tag MG5A6618-NY
TMX1 cDNA ORF Clone, Mouse, C-Myc tag MG5A6618-CM
TMX1 cDNA ORF Clone, Mouse, N-Myc tag MG5A6618-NM

TMX1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMX1 cDNA ORF Clone in Cloning Vector, Human HG14602-G
TMX1 cDNA ORF Clone, Human, untagged HG14602-UT
TMX1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14602-ACG
TMX1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14602-ACGLN
TMX1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14602-ACR
TMX1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14602-CF
TMX1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14602-NF
TMX1 cDNA ORF Clone, Human, C-His tag HG14602-CH
TMX1 cDNA ORF Clone, Human, N-His tag HG14602-NH
TMX1 cDNA ORF Clone, Human, C-HA tag HG14602-CY
TMX1 cDNA ORF Clone, Human, N-HA tag HG14602-NY
TMX1 cDNA ORF Clone, Human, C-Myc tag HG14602-CM
TMX1 cDNA ORF Clone, Human, N-Myc tag HG14602-NM
TMX1 qPCR Primer Pairs, Human HP103236
info info
添加购物车成功! 添加购物车失败!