TEX264 cDNA ORF Clone, Ferret, C-Myc tag

Cat: FG60151-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TEX264 Reagents
CRO Services
Product recommended

All TEX264 Reagents
TEX264 cDNA ORF Clone, Ferret, C-Myc tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
942 bp
Description
Full length Clone DNA of Ferret testis expressed 264 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TEX264 Background Information
Full Name
testis expressed 264

TEX264 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
TEX264 cDNA ORF Clone in Cloning Vector, Ferret FG60151-G
TEX264 cDNA ORF Clone, Ferret, untagged FG60151-UT
TEX264 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60151-ACGLN
TEX264 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60151-ACG
TEX264 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60151-ACR
TEX264 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60151-CF
TEX264 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60151-NF
TEX264 cDNA ORF Clone, Ferret, C-His tag FG60151-CH
TEX264 cDNA ORF Clone, Ferret, N-His tag FG60151-NH
TEX264 cDNA ORF Clone, Ferret, C-HA tag FG60151-CY
TEX264 cDNA ORF Clone, Ferret, N-HA tag FG60151-NY
TEX264 cDNA ORF Clone, Ferret, N-Myc tag FG60151-NM

TEX264 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TEX264 cDNA ORF Clone in Cloning Vector, Rat RG81352-G

TEX264 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TEX264 cDNA ORF Clone in Cloning Vector, Mouse MG51427-G
TEX264 cDNA ORF Clone, Mouse, untagged MG51427-UT
TEX264 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51427-ACG
TEX264 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51427-ACGLN
TEX264 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51427-ACR
TEX264 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51427-CF
TEX264 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51427-NF
TEX264 cDNA ORF Clone, Mouse, C-His tag MG51427-CH
TEX264 cDNA ORF Clone, Mouse, N-His tag MG51427-NH
TEX264 cDNA ORF Clone, Mouse, C-HA tag MG51427-CY
TEX264 cDNA ORF Clone, Mouse, N-HA tag MG51427-NY
TEX264 cDNA ORF Clone, Mouse, C-Myc tag MG51427-CM
TEX264 cDNA ORF Clone, Mouse, N-Myc tag MG51427-NM
TEX264 qPCR Primer Pairs, Mouse MP201311

TEX264 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TEX264 cDNA ORF Clone in Cloning Vector, Human HG13483-G
TEX264 cDNA ORF Clone, Human, untagged HG13483-UT
TEX264 cDNA ORF Clone, Human, C-GFPSpark® tag HG13483-ACG
TEX264 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13483-ACGLN
TEX264 cDNA ORF Clone, Human, C-OFPSpark® tag HG13483-ACR
TEX264 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13483-CF
TEX264 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13483-NF
TEX264 cDNA ORF Clone, Human, C-His tag HG13483-CH
TEX264 cDNA ORF Clone, Human, N-His tag HG13483-NH
TEX264 cDNA ORF Clone, Human, C-HA tag HG13483-CY
TEX264 cDNA ORF Clone, Human, N-HA tag HG13483-NY
TEX264 cDNA ORF Clone, Human, C-Myc tag HG13483-CM
TEX264 cDNA ORF Clone, Human, N-Myc tag HG13483-NM
TEX264 qPCR Primer Pairs, Human HP102183
info info
添加购物车成功! 添加购物车失败!