TAGLN2 cDNA ORF Clone, Ferret, N-HA tag

Cat: FG60149-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TAGLN2 Reagents
CRO Services
Product recommended

All TAGLN2 Reagents
TAGLN2 cDNA ORF Clone, Ferret, N-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
600 bp
Description
Full length Clone DNA of Ferret transgelin 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TAGLN2 Background Information
Full Name
transgelin 2

TAGLN2 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
TAGLN2 cDNA ORF Clone in Cloning Vector, Ferret FG60149-G
TAGLN2 cDNA ORF Clone, Ferret, untagged FG60149-UT
TAGLN2 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60149-ACG
TAGLN2 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60149-ACGLN
TAGLN2 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60149-ANG
TAGLN2 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60149-ACR
TAGLN2 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60149-ANR
TAGLN2 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60149-CF
TAGLN2 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60149-NF
TAGLN2 cDNA ORF Clone, Ferret, C-His tag FG60149-CH
TAGLN2 cDNA ORF Clone, Ferret, N-His tag FG60149-NH
TAGLN2 cDNA ORF Clone, Ferret, C-HA tag FG60149-CY
TAGLN2 cDNA ORF Clone, Ferret, C-Myc tag FG60149-CM
TAGLN2 cDNA ORF Clone, Ferret, N-Myc tag FG60149-NM

TAGLN2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TAGLN2 cDNA ORF Clone in Cloning Vector, Rat RG80876-U
TAGLN2 cDNA ORF Clone, Rat, untagged RG80876-UT
TAGLN2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80876-ACG
TAGLN2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80876-ACGLN
TAGLN2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80876-ANG
TAGLN2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80876-ACR
TAGLN2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80876-ANR
TAGLN2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80876-CF
TAGLN2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80876-NF
TAGLN2 cDNA ORF Clone, Rat, C-His tag RG80876-CH
TAGLN2 cDNA ORF Clone, Rat, N-His tag RG80876-NH
TAGLN2 cDNA ORF Clone, Rat, C-HA tag RG80876-CY
TAGLN2 cDNA ORF Clone, Rat, N-HA tag RG80876-NY
TAGLN2 cDNA ORF Clone, Rat, C-Myc tag RG80876-CM
TAGLN2 cDNA ORF Clone, Rat, N-Myc tag RG80876-NM
TAGLN2 qPCR Primer Pairs, Rat RP300840

TAGLN2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TAGLN2 cDNA ORF Clone in Cloning Vector, Mouse MG53229-G
TAGLN2 cDNA ORF Clone, Mouse, untagged MG53229-UT
TAGLN2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53229-ACG
TAGLN2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53229-ACGLN
TAGLN2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53229-ANG
TAGLN2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53229-ACR
TAGLN2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53229-ANR
TAGLN2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53229-CF
TAGLN2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53229-NF
TAGLN2 cDNA ORF Clone, Mouse, C-His tag MG53229-CH
TAGLN2 cDNA ORF Clone, Mouse, N-His tag MG53229-NH
TAGLN2 cDNA ORF Clone, Mouse, C-HA tag MG53229-CY
TAGLN2 cDNA ORF Clone, Mouse, N-HA tag MG53229-NY
TAGLN2 cDNA ORF Clone, Mouse, C-Myc tag MG53229-CM
TAGLN2 cDNA ORF Clone, Mouse, N-Myc tag MG53229-NM

TAGLN2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TAGLN2 cDNA ORF Clone in Cloning Vector, Human HG16472-G
TAGLN2 cDNA ORF Clone, Human, untagged HG16472-UT
TAGLN2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16472-ACG
TAGLN2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16472-ACGLN
TAGLN2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16472-ANG
TAGLN2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16472-ACR
TAGLN2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16472-ANR
TAGLN2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16472-CF
TAGLN2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16472-NF
TAGLN2 cDNA ORF Clone, Human, C-His tag HG16472-CH
TAGLN2 cDNA ORF Clone, Human, N-His tag HG16472-NH
TAGLN2 cDNA ORF Clone, Human, C-HA tag HG16472-CY
TAGLN2 cDNA ORF Clone, Human, N-HA tag HG16472-NY
TAGLN2 cDNA ORF Clone, Human, C-Myc tag HG16472-CM
TAGLN2 cDNA ORF Clone, Human, N-Myc tag HG16472-NM
TAGLN2 qPCR Primer Pairs, Human HP105217
info info
添加购物车成功! 添加购物车失败!