Syntaxin 8 cDNA ORF Clone, Ferret, untagged

Cat: FG60077-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Syntaxin 8 Reagents
CRO Services
Product recommended

All Syntaxin 8 Reagents
Syntaxin 8 cDNA ORF Clone, Ferret, untagged General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
711 bp
Description
Full length Clone DNA of Ferret syntaxin 8.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Syntaxin 8 Background Information

STX8, also known as syntaxin 8, directly interacts with HECTd3. STX8 forms the SNARE complex with syntaxin 7, vti1b and endobrevin. STX8 belongs to the syntaxin family. Members of this family are key molecules implicated in diverse vesicle docking and membrane fusion events. STX8 physically interacts with cystic fibrosis transmembrane conductance regulator (CFTR): recombinant syntaxin 8 binds CFTR in vitro and both proteins co-immunoprecipitate in HT29 cells. Syntaxin 8 regulates CFTR-mediated currents in chinese hamster ovary (CHO) cells stably expressing CFTR and syntaxin 8. STX8 contributes to the regulation of CFTR trafficking and chloride channel activity by the SNARE machinery.

Full Name
syntaxin 8
References
  • Steegmaier M. et al., 1999, J Biol Chem. 273 (51): 34171-9.
  • Thoreau V. et al., 1999, Biochem Biophys Res Commun. 257 (2): 577-83.
  • Zhang L. et al., 2009, Cell Mol Neurobiol. 29 (1): 115-21.
  • Bilan F. et al., 2004, J Cell Sci. 117 (10): 1923-35.
  • Syntaxin 8 cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    Syntaxin 8 cDNA ORF Clone in Cloning Vector, Ferret FG60077-G
    Syntaxin 8 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60077-ACGLN
    Syntaxin 8 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60077-ACG
    Syntaxin 8 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60077-ANG
    Syntaxin 8 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60077-ACR
    Syntaxin 8 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60077-ANR
    Syntaxin 8 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60077-CF
    Syntaxin 8 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60077-NF
    Syntaxin 8 cDNA ORF Clone, Ferret, C-His tag FG60077-CH
    Syntaxin 8 cDNA ORF Clone, Ferret, N-His tag FG60077-NH
    Syntaxin 8 cDNA ORF Clone, Ferret, C-HA tag FG60077-CY
    Syntaxin 8 cDNA ORF Clone, Ferret, N-HA tag FG60077-NY
    Syntaxin 8 cDNA ORF Clone, Ferret, C-Myc tag FG60077-CM
    Syntaxin 8 cDNA ORF Clone, Ferret, N-Myc tag FG60077-NM

    Syntaxin 8 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Syntaxin 8 cDNA ORF Clone in Cloning Vector, Human HG14243-G
    Syntaxin 8 cDNA ORF Clone, Human, untagged HG14243-UT
    Syntaxin 8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14243-ACGLN
    Syntaxin 8 cDNA ORF Clone, Human, C-GFPSpark® tag HG14243-ACG
    Syntaxin 8 cDNA ORF Clone, Human, N-GFPSpark® tag HG14243-ANG
    Syntaxin 8 cDNA ORF Clone, Human, C-OFPSpark® tag HG14243-ACR
    Syntaxin 8 cDNA ORF Clone, Human, N-OFPSpark® tag HG14243-ANR
    Syntaxin 8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14243-CF
    Syntaxin 8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14243-NF
    Syntaxin 8 cDNA ORF Clone, Human, C-His tag HG14243-CH
    Syntaxin 8 cDNA ORF Clone, Human, N-His tag HG14243-NH
    Syntaxin 8 cDNA ORF Clone, Human, C-HA tag HG14243-CY
    Syntaxin 8 cDNA ORF Clone, Human, N-HA tag HG14243-NY
    Syntaxin 8 cDNA ORF Clone, Human, C-Myc tag HG14243-CM
    Syntaxin 8 cDNA ORF Clone, Human, N-Myc tag HG14243-NM
    Syntaxin 8 qPCR Primer Pairs, Human HP102893
    info info
    添加购物车成功! 添加购物车失败!