SERBP1 cDNA ORF Clone, Ferret, C-HA tag

Cat: FG60110-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SERBP1 Reagents
CRO Services
Product recommended

All SERBP1 Reagents
SERBP1 cDNA ORF Clone, Ferret, C-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1179 bp
Description
Full length Clone DNA of Ferret SERPINE1 mRNA binding protein 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SERBP1 Background Information
Full Name
SERPINE1 mRNA binding protein 1

SERBP1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
SERBP1 cDNA ORF Clone in Cloning Vector, Ferret FG60110-G
SERBP1 cDNA ORF Clone, Ferret, untagged FG60110-UT
SERBP1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60110-ACG
SERBP1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60110-ACGLN
SERBP1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60110-ANG
SERBP1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60110-ACR
SERBP1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60110-ANR
SERBP1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60110-CF
SERBP1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60110-NF
SERBP1 cDNA ORF Clone, Ferret, C-His tag FG60110-CH
SERBP1 cDNA ORF Clone, Ferret, N-His tag FG60110-NH
SERBP1 cDNA ORF Clone, Ferret, N-HA tag FG60110-NY
SERBP1 cDNA ORF Clone, Ferret, C-Myc tag FG60110-CM
SERBP1 cDNA ORF Clone, Ferret, N-Myc tag FG60110-NM

SERBP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SERBP1 cDNA ORF Clone in Cloning Vector, Rat RG84247-U
SERBP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84247-ACGLN

SERBP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SERBP1 cDNA ORF Clone in Cloning Vector, Mouse MG52294-G
SERBP1 cDNA ORF Clone, Mouse, untagged MG52294-UT
SERBP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52294-ACGLN
SERBP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52294-ACG
SERBP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52294-ANG
SERBP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52294-ACR
SERBP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52294-ANR
SERBP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52294-CF
SERBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52294-NF
SERBP1 cDNA ORF Clone, Mouse, C-His tag MG52294-CH
SERBP1 cDNA ORF Clone, Mouse, N-His tag MG52294-NH
SERBP1 cDNA ORF Clone, Mouse, C-HA tag MG52294-CY
SERBP1 cDNA ORF Clone, Mouse, N-HA tag MG52294-NY
SERBP1 cDNA ORF Clone, Mouse, C-Myc tag MG52294-CM
SERBP1 cDNA ORF Clone, Mouse, N-Myc tag MG52294-NM
SERBP1 qPCR Primer Pairs, Mouse MP202167

SERBP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SERBP1 cDNA ORF Clone in Cloning Vector, Human HG16586-U
SERBP1 cDNA ORF Clone, Human, untagged HG16586-UT
SERBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16586-ACGLN
SERBP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16586-ACG
SERBP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16586-ANG
SERBP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16586-ACR
SERBP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16586-ANR
SERBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16586-CF
SERBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16586-NF
SERBP1 cDNA ORF Clone, Human, C-His tag HG16586-CH
SERBP1 cDNA ORF Clone, Human, N-His tag HG16586-NH
SERBP1 cDNA ORF Clone, Human, C-HA tag HG16586-CY
SERBP1 cDNA ORF Clone, Human, N-HA tag HG16586-NY
SERBP1 cDNA ORF Clone, Human, C-Myc tag HG16586-CM
SERBP1 cDNA ORF Clone, Human, N-Myc tag HG16586-NM
info info
添加购物车成功! 添加购物车失败!