RSU1 cDNA ORF Clone, Ferret, N-HA tag

Cat: FG60090-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RSU1 Reagents
CRO Services
Product recommended

All RSU1 Reagents
RSU1 cDNA ORF Clone, Ferret, N-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
834 bp
Description
Full length Clone DNA of Ferret Ras suppressor protein 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RSU1 Background Information
Full Name
Ras suppressor protein 1

RSU1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
RSU1 cDNA ORF Clone in Cloning Vector, Ferret FG60090-G
RSU1 cDNA ORF Clone, Ferret, untagged FG60090-UT
RSU1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60090-ACG
RSU1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60090-ACGLN
RSU1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60090-ANG
RSU1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60090-ACR
RSU1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60090-ANR
RSU1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60090-CF
RSU1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60090-NF
RSU1 cDNA ORF Clone, Ferret, C-His tag FG60090-CH
RSU1 cDNA ORF Clone, Ferret, N-His tag FG60090-NH
RSU1 cDNA ORF Clone, Ferret, C-HA tag FG60090-CY
RSU1 cDNA ORF Clone, Ferret, C-Myc tag FG60090-CM
RSU1 cDNA ORF Clone, Ferret, N-Myc tag FG60090-NM

RSU1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RSU1 cDNA ORF Clone in Cloning Vector, Rat RG80855-U
RSU1 cDNA ORF Clone, Rat, untagged RG80855-UT
RSU1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80855-ACG
RSU1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80855-ACGLN
RSU1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80855-ANG
RSU1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80855-ACR
RSU1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80855-ANR
RSU1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80855-CF
RSU1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80855-NF
RSU1 cDNA ORF Clone, Rat, C-His tag RG80855-CH
RSU1 cDNA ORF Clone, Rat, N-His tag RG80855-NH
RSU1 cDNA ORF Clone, Rat, C-HA tag RG80855-CY
RSU1 cDNA ORF Clone, Rat, N-HA tag RG80855-NY
RSU1 cDNA ORF Clone, Rat, C-Myc tag RG80855-CM
RSU1 cDNA ORF Clone, Rat, N-Myc tag RG80855-NM
RSU1 qPCR Primer Pairs, Rat RP300819

RSU1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RSU1 cDNA ORF Clone in Cloning Vector, Mouse MG53805-U
RSU1 cDNA ORF Clone, Mouse, untagged MG53805-UT
RSU1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53805-ACGLN
RSU1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53805-ACG
RSU1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53805-ANG
RSU1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53805-ACR
RSU1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53805-ANR
RSU1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53805-CF
RSU1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53805-NF
RSU1 cDNA ORF Clone, Mouse, C-His tag MG53805-CH
RSU1 cDNA ORF Clone, Mouse, N-His tag MG53805-NH
RSU1 cDNA ORF Clone, Mouse, C-HA tag MG53805-CY
RSU1 cDNA ORF Clone, Mouse, N-HA tag MG53805-NY
RSU1 cDNA ORF Clone, Mouse, C-Myc tag MG53805-CM
RSU1 cDNA ORF Clone, Mouse, N-Myc tag MG53805-NM

RSU1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RSU1 cDNA ORF Clone in Cloning Vector, Human HG16900-U
RSU1 cDNA ORF Clone, Human, untagged HG16900-UT
RSU1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16900-ACG
RSU1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16900-ACGLN
RSU1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16900-ANG
RSU1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16900-ACR
RSU1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16900-ANR
RSU1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16900-CF
RSU1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16900-NF
RSU1 cDNA ORF Clone, Human, C-His tag HG16900-CH
RSU1 cDNA ORF Clone, Human, N-His tag HG16900-NH
RSU1 cDNA ORF Clone, Human, C-HA tag HG16900-CY
RSU1 cDNA ORF Clone, Human, N-HA tag HG16900-NY
RSU1 cDNA ORF Clone, Human, C-Myc tag HG16900-CM
RSU1 cDNA ORF Clone, Human, N-Myc tag HG16900-NM
info info
添加购物车成功! 添加购物车失败!