RPF1 cDNA ORF Clone, Ferret, C-His tag

Cat: FG60135-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPF1 Reagents
CRO Services
Product recommended

All RPF1 Reagents
RPF1 cDNA ORF Clone, Ferret, C-His tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1050 bp
Description
Full length Clone DNA of Ferret ribosome production factor 1 homolog (S. cerevisiae) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPF1 Background Information
Full Name
ribosome production factor 1 homolog (S. cerevisiae)

RPF1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
RPF1 cDNA ORF Clone in Cloning Vector, Ferret FG60135-G
RPF1 cDNA ORF Clone, Ferret, untagged FG60135-UT
RPF1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60135-ACGLN
RPF1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60135-ACG
RPF1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60135-ANG
RPF1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60135-ACR
RPF1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60135-ANR
RPF1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60135-CF
RPF1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60135-NF
RPF1 cDNA ORF Clone, Ferret, N-His tag FG60135-NH
RPF1 cDNA ORF Clone, Ferret, C-HA tag FG60135-CY
RPF1 cDNA ORF Clone, Ferret, N-HA tag FG60135-NY
RPF1 cDNA ORF Clone, Ferret, C-Myc tag FG60135-CM
RPF1 cDNA ORF Clone, Ferret, N-Myc tag FG60135-NM

RPF1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPF1 cDNA ORF Clone in Cloning Vector, Rat RG88782-U
RPF1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG88782-ACGLN

RPF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPF1 cDNA ORF Clone in Cloning Vector, Human HG25011-U
RPF1 cDNA ORF Clone, Human, untagged HG25011-UT
RPF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG25011-ACG
RPF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG25011-ACGLN
RPF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG25011-ANG
RPF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG25011-ACR
RPF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG25011-ANR
RPF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG25011-CF
RPF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG25011-NF
RPF1 cDNA ORF Clone, Human, C-His tag HG25011-CH
RPF1 cDNA ORF Clone, Human, N-His tag HG25011-NH
RPF1 cDNA ORF Clone, Human, C-HA tag HG25011-CY
RPF1 cDNA ORF Clone, Human, N-HA tag HG25011-NY
RPF1 cDNA ORF Clone, Human, C-Myc tag HG25011-CM
RPF1 cDNA ORF Clone, Human, N-Myc tag HG25011-NM
info info
添加购物车成功! 添加购物车失败!