PSMG3 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag

Cat: FG60121-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSMG3 Reagents
CRO Services
Product recommended

All PSMG3 Reagents
PSMG3 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
369 bp
Description
Full length Clone DNA of Ferret proteasome (prosome, macropain) assembly chaperone 3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMG3 Background Information
Full Name
proteasome (prosome, macropain) assembly chaperone 3

PSMG3 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
PSMG3 cDNA ORF Clone in Cloning Vector, Ferret FG60121-G
PSMG3 cDNA ORF Clone, Ferret, untagged FG60121-UT
PSMG3 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60121-ACG
PSMG3 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60121-ACGLN
PSMG3 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60121-ANG
PSMG3 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60121-ACR
PSMG3 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60121-ANR
PSMG3 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60121-CF
PSMG3 cDNA ORF Clone, Ferret, C-His tag FG60121-CH
PSMG3 cDNA ORF Clone, Ferret, N-His tag FG60121-NH
PSMG3 cDNA ORF Clone, Ferret, C-HA tag FG60121-CY
PSMG3 cDNA ORF Clone, Ferret, N-HA tag FG60121-NY
PSMG3 cDNA ORF Clone, Ferret, C-Myc tag FG60121-CM
PSMG3 cDNA ORF Clone, Ferret, N-Myc tag FG60121-NM

PSMG3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMG3 cDNA ORF Clone in Cloning Vector, Mouse MG55846-U
PSMG3 cDNA ORF Clone, Mouse, untagged MG55846-UT
PSMG3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG55846-ACGLN
PSMG3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG55846-ACG
PSMG3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG55846-ANG
PSMG3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG55846-ACR
PSMG3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG55846-ANR
PSMG3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG55846-CF
PSMG3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG55846-NF
PSMG3 cDNA ORF Clone, Mouse, C-His tag MG55846-CH
PSMG3 cDNA ORF Clone, Mouse, N-His tag MG55846-NH
PSMG3 cDNA ORF Clone, Mouse, C-HA tag MG55846-CY
PSMG3 cDNA ORF Clone, Mouse, N-HA tag MG55846-NY
PSMG3 cDNA ORF Clone, Mouse, C-Myc tag MG55846-CM
PSMG3 cDNA ORF Clone, Mouse, N-Myc tag MG55846-NM

PSMG3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMG3 cDNA ORF Clone in Cloning Vector, Human HG14980-G
PSMG3 cDNA ORF Clone, Human, untagged HG14980-UT
PSMG3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14980-ACGLN
PSMG3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14980-ACG
PSMG3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14980-ANG
PSMG3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14980-ACR
PSMG3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14980-ANR
PSMG3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14980-CF
PSMG3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14980-NF
PSMG3 cDNA ORF Clone, Human, C-His tag HG14980-CH
PSMG3 cDNA ORF Clone, Human, N-His tag HG14980-NH
PSMG3 cDNA ORF Clone, Human, C-HA tag HG14980-CY
PSMG3 cDNA ORF Clone, Human, N-HA tag HG14980-NY
PSMG3 cDNA ORF Clone, Human, C-Myc tag HG14980-CM
PSMG3 cDNA ORF Clone, Human, N-Myc tag HG14980-NM
PSMG3 qPCR Primer Pairs, Human HP103608
info info
添加购物车成功! 添加购物车失败!