PRR13 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag

Cat: FG60138-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PRR13 Reagents
CRO Services
Product recommended

All PRR13 Reagents
PRR13 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
432 bp
Description
Full length Clone DNA of Ferret proline rich 13 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRR13 Background Information
Full Name
proline rich 13

PRR13 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
PRR13 cDNA ORF Clone in Cloning Vector, Ferret FG60138-G
PRR13 cDNA ORF Clone, Ferret, untagged FG60138-UT
PRR13 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60138-ACG
PRR13 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60138-ACGLN
PRR13 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60138-ANG
PRR13 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60138-ACR
PRR13 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60138-ANR
PRR13 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60138-CF
PRR13 cDNA ORF Clone, Ferret, C-His tag FG60138-CH
PRR13 cDNA ORF Clone, Ferret, N-His tag FG60138-NH
PRR13 cDNA ORF Clone, Ferret, C-HA tag FG60138-CY
PRR13 cDNA ORF Clone, Ferret, N-HA tag FG60138-NY
PRR13 cDNA ORF Clone, Ferret, C-Myc tag FG60138-CM
PRR13 cDNA ORF Clone, Ferret, N-Myc tag FG60138-NM

PRR13 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PRR13 cDNA ORF Clone in Cloning Vector, Rat RG81188-U
PRR13 cDNA ORF Clone, Rat, untagged RG81188-UT
PRR13 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81188-ACGLN
PRR13 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81188-ACG
PRR13 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81188-ANG
PRR13 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81188-ACR
PRR13 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81188-ANR
PRR13 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81188-CF
PRR13 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81188-NF
PRR13 cDNA ORF Clone, Rat, C-His tag RG81188-CH
PRR13 cDNA ORF Clone, Rat, N-His tag RG81188-NH
PRR13 cDNA ORF Clone, Rat, C-HA tag RG81188-CY
PRR13 cDNA ORF Clone, Rat, N-HA tag RG81188-NY
PRR13 cDNA ORF Clone, Rat, C-Myc tag RG81188-CM
PRR13 cDNA ORF Clone, Rat, N-Myc tag RG81188-NM
PRR13 qPCR Primer Pairs, Rat RP301144

PRR13 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRR13 cDNA ORF Clone in Cloning Vector, Mouse MG53190-G
PRR13 cDNA ORF Clone, Mouse, untagged MG53190-UT
PRR13 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53190-ACG
PRR13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53190-ACGLN
PRR13 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53190-ANG
PRR13 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53190-ACR
PRR13 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53190-ANR
PRR13 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53190-CF
PRR13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53190-NF
PRR13 cDNA ORF Clone, Mouse, C-His tag MG53190-CH
PRR13 cDNA ORF Clone, Mouse, N-His tag MG53190-NH
PRR13 cDNA ORF Clone, Mouse, C-HA tag MG53190-CY
PRR13 cDNA ORF Clone, Mouse, N-HA tag MG53190-NY
PRR13 cDNA ORF Clone, Mouse, C-Myc tag MG53190-CM
PRR13 cDNA ORF Clone, Mouse, N-Myc tag MG53190-NM

PRR13 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRR13 cDNA ORF Clone in Cloning Vector, Human HG17213-U
PRR13 cDNA ORF Clone, Human, untagged HG17213-UT
PRR13 cDNA ORF Clone, Human, C-GFPSpark® tag HG17213-ACG
PRR13 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17213-ACGLN
PRR13 cDNA ORF Clone, Human, N-GFPSpark® tag HG17213-ANG
PRR13 cDNA ORF Clone, Human, C-OFPSpark® tag HG17213-ACR
PRR13 cDNA ORF Clone, Human, N-OFPSpark® tag HG17213-ANR
PRR13 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17213-CF
PRR13 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17213-NF
PRR13 cDNA ORF Clone, Human, C-His tag HG17213-CH
PRR13 cDNA ORF Clone, Human, N-His tag HG17213-NH
PRR13 cDNA ORF Clone, Human, C-HA tag HG17213-CY
PRR13 cDNA ORF Clone, Human, N-HA tag HG17213-NY
PRR13 cDNA ORF Clone, Human, C-Myc tag HG17213-CM
PRR13 cDNA ORF Clone, Human, N-Myc tag HG17213-NM
info info
添加购物车成功! 添加购物车失败!