PM20D1 cDNA ORF Clone, Ferret, C-Myc tag

Cat: FG60132-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PM20D1 Reagents
CRO Services
Product recommended

All PM20D1 Reagents
PM20D1 cDNA ORF Clone, Ferret, C-Myc tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1512 bp
Description
Full length Clone DNA of Ferret peptidase M20 domain containing 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PM20D1 Background Information
Full Name
peptidase M20 domain containing 1

PM20D1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
PM20D1 cDNA ORF Clone in Cloning Vector, Ferret FG60132-G
PM20D1 cDNA ORF Clone, Ferret, untagged FG60132-UT
PM20D1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60132-ACG
PM20D1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60132-ACGLN
PM20D1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60132-ACR
PM20D1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60132-CF
PM20D1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60132-NF
PM20D1 cDNA ORF Clone, Ferret, C-His tag FG60132-CH
PM20D1 cDNA ORF Clone, Ferret, N-His tag FG60132-NH
PM20D1 cDNA ORF Clone, Ferret, C-HA tag FG60132-CY
PM20D1 cDNA ORF Clone, Ferret, N-HA tag FG60132-NY
PM20D1 cDNA ORF Clone, Ferret, N-Myc tag FG60132-NM

PM20D1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PM20D1 cDNA ORF Clone in Cloning Vector, Mouse MG53735-U
PM20D1 cDNA ORF Clone, Mouse, untagged MG53735-UT
PM20D1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53735-ACGLN
PM20D1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53735-ACG
PM20D1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53735-ACR
PM20D1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53735-CF
PM20D1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53735-NF
PM20D1 cDNA ORF Clone, Mouse, C-His tag MG53735-CH
PM20D1 cDNA ORF Clone, Mouse, N-His tag MG53735-NH
PM20D1 cDNA ORF Clone, Mouse, C-HA tag MG53735-CY
PM20D1 cDNA ORF Clone, Mouse, N-HA tag MG53735-NY
PM20D1 cDNA ORF Clone, Mouse, C-Myc tag MG53735-CM
PM20D1 cDNA ORF Clone, Mouse, N-Myc tag MG53735-NM

PM20D1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PM20D1 cDNA ORF Clone in Cloning Vector, Human HG13778-G
PM20D1 cDNA ORF Clone, Human, untagged HG13778-UT
PM20D1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13778-ACG
PM20D1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13778-ACGLN
PM20D1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13778-ACR
PM20D1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13778-CF
PM20D1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13778-NF
PM20D1 cDNA ORF Clone, Human, C-His tag HG13778-CH
PM20D1 cDNA ORF Clone, Human, N-His tag HG13778-NH
PM20D1 cDNA ORF Clone, Human, C-HA tag HG13778-CY
PM20D1 cDNA ORF Clone, Human, N-HA tag HG13778-NY
PM20D1 cDNA ORF Clone, Human, C-Myc tag HG13778-CM
PM20D1 cDNA ORF Clone, Human, N-Myc tag HG13778-NM
PM20D1 qPCR Primer Pairs, Human HP102453
info info
添加购物车成功! 添加购物车失败!