PDLIM1 cDNA ORF Clone, Ferret, N-HA tag

Cat: FG60130-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PDLIM1 Reagents
CRO Services
Product recommended

All PDLIM1 Reagents
PDLIM1 cDNA ORF Clone, Ferret, N-HA tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
990 bp
Description
Full length Clone DNA of Ferret PDZ and LIM domain 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDLIM1 Background Information
Full Name
PDZ and LIM domain 1

PDLIM1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
PDLIM1 cDNA ORF Clone in Cloning Vector, Ferret FG60130-G
PDLIM1 cDNA ORF Clone, Ferret, untagged FG60130-UT
PDLIM1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60130-ACGLN
PDLIM1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60130-ACG
PDLIM1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60130-ANG
PDLIM1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60130-ACR
PDLIM1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60130-ANR
PDLIM1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60130-CF
PDLIM1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60130-NF
PDLIM1 cDNA ORF Clone, Ferret, C-His tag FG60130-CH
PDLIM1 cDNA ORF Clone, Ferret, N-His tag FG60130-NH
PDLIM1 cDNA ORF Clone, Ferret, C-HA tag FG60130-CY
PDLIM1 cDNA ORF Clone, Ferret, C-Myc tag FG60130-CM
PDLIM1 cDNA ORF Clone, Ferret, N-Myc tag FG60130-NM

PDLIM1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PDLIM1 cDNA ORF Clone in Cloning Vector, Rat RG80843-U
PDLIM1 cDNA ORF Clone, Rat, untagged RG80843-UT
PDLIM1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80843-ACG
PDLIM1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80843-ACGLN
PDLIM1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80843-ANG
PDLIM1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80843-ACR
PDLIM1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80843-ANR
PDLIM1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80843-CF
PDLIM1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80843-NF
PDLIM1 cDNA ORF Clone, Rat, C-His tag RG80843-CH
PDLIM1 cDNA ORF Clone, Rat, N-His tag RG80843-NH
PDLIM1 cDNA ORF Clone, Rat, C-HA tag RG80843-CY
PDLIM1 cDNA ORF Clone, Rat, N-HA tag RG80843-NY
PDLIM1 cDNA ORF Clone, Rat, C-Myc tag RG80843-CM
PDLIM1 cDNA ORF Clone, Rat, N-Myc tag RG80843-NM
PDLIM1 qPCR Primer Pairs, Rat RP300807

PDLIM1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PDLIM1 cDNA ORF Clone in Cloning Vector, Mouse MG53223-G
PDLIM1 cDNA ORF Clone, Mouse, untagged MG53223-UT
PDLIM1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53223-ACG
PDLIM1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53223-ACGLN
PDLIM1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53223-ANG
PDLIM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53223-ACR
PDLIM1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53223-ANR
PDLIM1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53223-CF
PDLIM1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53223-NF
PDLIM1 cDNA ORF Clone, Mouse, C-His tag MG53223-CH
PDLIM1 cDNA ORF Clone, Mouse, N-His tag MG53223-NH
PDLIM1 cDNA ORF Clone, Mouse, C-HA tag MG53223-CY
PDLIM1 cDNA ORF Clone, Mouse, N-HA tag MG53223-NY
PDLIM1 cDNA ORF Clone, Mouse, C-Myc tag MG53223-CM
PDLIM1 cDNA ORF Clone, Mouse, N-Myc tag MG53223-NM

PDLIM1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PDLIM1 cDNA ORF Clone in Cloning Vector, Human HG20253-U
PDLIM1 cDNA ORF Clone, Human, untagged HG20253-UT
PDLIM1 cDNA ORF Clone, Human, C-GFPSpark® tag HG20253-ACG
PDLIM1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20253-ACGLN
PDLIM1 cDNA ORF Clone, Human, N-GFPSpark® tag HG20253-ANG
PDLIM1 cDNA ORF Clone, Human, C-OFPSpark® tag HG20253-ACR
PDLIM1 cDNA ORF Clone, Human, N-OFPSpark® tag HG20253-ANR
PDLIM1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG20253-CF
PDLIM1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG20253-NF
PDLIM1 cDNA ORF Clone, Human, C-His tag HG20253-CH
PDLIM1 cDNA ORF Clone, Human, N-His tag HG20253-NH
PDLIM1 cDNA ORF Clone, Human, C-HA tag HG20253-CY
PDLIM1 cDNA ORF Clone, Human, N-HA tag HG20253-NY
PDLIM1 cDNA ORF Clone, Human, C-Myc tag HG20253-CM
PDLIM1 cDNA ORF Clone, Human, N-Myc tag HG20253-NM
info info
添加购物车成功! 添加购物车失败!