PDHB cDNA ORF Clone, Ferret, C-His tag

Cat: FG60070-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PDHB Reagents
CRO Services
Product recommended

All PDHB Reagents
PDHB cDNA ORF Clone, Ferret, C-His tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1080 bp
Description
Full length Clone DNA of Ferret pyruvate dehydrogenase (lipoamide) beta with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDHB Background Information
Full Name
pyruvate dehydrogenase (lipoamide) beta

PDHB cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
PDHB cDNA ORF Clone in Cloning Vector, Ferret FG60070-G
PDHB cDNA ORF Clone, Ferret, untagged FG60070-UT
PDHB Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60070-ACGLN
PDHB cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60070-ACG
PDHB cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60070-ANG
PDHB cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60070-ACR
PDHB cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60070-ANR
PDHB cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60070-CF
PDHB cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60070-NF
PDHB cDNA ORF Clone, Ferret, N-His tag FG60070-NH
PDHB cDNA ORF Clone, Ferret, C-HA tag FG60070-CY
PDHB cDNA ORF Clone, Ferret, N-HA tag FG60070-NY
PDHB cDNA ORF Clone, Ferret, C-Myc tag FG60070-CM
PDHB cDNA ORF Clone, Ferret, N-Myc tag FG60070-NM

PDHB cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
PDHB cDNA ORF Clone in Cloning Vector, Rabbit TG65099-G
PDHB cDNA ORF Clone, Rabbit, untagged TG65099-UT
PDHB cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65099-ACG
PDHB cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65099-ANG
PDHB cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65099-ACR
PDHB cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65099-ANR
PDHB cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65099-CF
PDHB cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65099-NF
PDHB cDNA ORF Clone, Rabbit, C-His tag TG65099-CH
PDHB cDNA ORF Clone, Rabbit, N-His tag TG65099-NH
PDHB cDNA ORF Clone, Rabbit, C-HA tag TG65099-CY
PDHB cDNA ORF Clone, Rabbit, N-HA tag TG65099-NY
PDHB cDNA ORF Clone, Rabbit, C-Myc tag TG65099-CM
PDHB cDNA ORF Clone, Rabbit, N-Myc tag TG65099-NM

PDHB cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PDHB cDNA ORF Clone in Cloning Vector, Rat RG81463-G

PDHB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PDHB cDNA ORF Clone in Cloning Vector, Mouse MG52597-G
PDHB cDNA ORF Clone, Mouse, untagged MG52597-UT
PDHB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52597-ACGLN
PDHB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52597-ACG
PDHB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52597-ANG
PDHB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52597-ACR
PDHB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52597-ANR
PDHB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52597-CF
PDHB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52597-NF
PDHB cDNA ORF Clone, Mouse, C-His tag MG52597-CH
PDHB cDNA ORF Clone, Mouse, N-His tag MG52597-NH
PDHB cDNA ORF Clone, Mouse, C-HA tag MG52597-CY
PDHB cDNA ORF Clone, Mouse, N-HA tag MG52597-NY
PDHB cDNA ORF Clone, Mouse, C-Myc tag MG52597-CM
PDHB cDNA ORF Clone, Mouse, N-Myc tag MG52597-NM
PDHB qPCR Primer Pairs, Mouse MP202468

PDHB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PDHB cDNA ORF Clone in Cloning Vector, Human HG16533-G
PDHB cDNA ORF Clone, Human, untagged HG16533-UT
PDHB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16533-ACGLN
PDHB cDNA ORF Clone, Human, C-GFPSpark® tag HG16533-ACG
PDHB cDNA ORF Clone, Human, N-GFPSpark® tag HG16533-ANG
PDHB cDNA ORF Clone, Human, C-OFPSpark® tag HG16533-ACR
PDHB cDNA ORF Clone, Human, N-OFPSpark® tag HG16533-ANR
PDHB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16533-CF
PDHB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16533-NF
PDHB cDNA ORF Clone, Human, C-His tag HG16533-CH
PDHB cDNA ORF Clone, Human, N-His tag HG16533-NH
PDHB cDNA ORF Clone, Human, C-HA tag HG16533-CY
PDHB cDNA ORF Clone, Human, N-HA tag HG16533-NY
PDHB cDNA ORF Clone, Human, C-Myc tag HG16533-CM
PDHB cDNA ORF Clone, Human, N-Myc tag HG16533-NM
info info
添加购物车成功! 添加购物车失败!