PCIF1 cDNA ORF Clone, Ferret, C-Myc tag

Cat: FG60127-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PCIF1 Reagents
CRO Services
Product recommended

All PCIF1 Reagents
PCIF1 cDNA ORF Clone, Ferret, C-Myc tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
2109 bp
Description
Full length Clone DNA of Ferret PDX1 C-terminal inhibiting factor 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PCIF1 Background Information
Full Name
PDX1 C-terminal inhibiting factor 1

PCIF1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
PCIF1 cDNA ORF Clone in Cloning Vector, Ferret FG60127-G
PCIF1 cDNA ORF Clone, Ferret, untagged FG60127-UT
PCIF1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60127-ACG
PCIF1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60127-ACGLN
PCIF1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60127-ANG
PCIF1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60127-ACR
PCIF1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60127-ANR
PCIF1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60127-CF
PCIF1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60127-NF
PCIF1 cDNA ORF Clone, Ferret, C-His tag FG60127-CH
PCIF1 cDNA ORF Clone, Ferret, N-His tag FG60127-NH
PCIF1 cDNA ORF Clone, Ferret, C-HA tag FG60127-CY
PCIF1 cDNA ORF Clone, Ferret, N-HA tag FG60127-NY
PCIF1 cDNA ORF Clone, Ferret, N-Myc tag FG60127-NM

PCIF1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PCIF1 cDNA ORF Clone in Cloning Vector, Rat RG81425-G

PCIF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PCIF1 cDNA ORF Clone in Cloning Vector, Mouse MG53685-U
PCIF1 cDNA ORF Clone, Mouse, untagged MG53685-UT
PCIF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53685-ACGLN
PCIF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53685-ACG
PCIF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53685-ANG
PCIF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53685-ACR
PCIF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53685-ANR
PCIF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53685-CF
PCIF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53685-NF
PCIF1 cDNA ORF Clone, Mouse, C-His tag MG53685-CH
PCIF1 cDNA ORF Clone, Mouse, N-His tag MG53685-NH
PCIF1 cDNA ORF Clone, Mouse, C-HA tag MG53685-CY
PCIF1 cDNA ORF Clone, Mouse, N-HA tag MG53685-NY
PCIF1 cDNA ORF Clone, Mouse, C-Myc tag MG53685-CM
PCIF1 cDNA ORF Clone, Mouse, N-Myc tag MG53685-NM

PCIF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PCIF1 cDNA ORF Clone in Cloning Vector, Human HG16743-U
PCIF1 cDNA ORF Clone, Human, untagged HG16743-UT
PCIF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16743-ACG
PCIF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16743-ACGLN
PCIF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16743-ANG
PCIF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16743-ACR
PCIF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16743-ANR
PCIF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16743-CF
PCIF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16743-NF
PCIF1 cDNA ORF Clone, Human, C-His tag HG16743-CH
PCIF1 cDNA ORF Clone, Human, N-His tag HG16743-NH
PCIF1 cDNA ORF Clone, Human, C-HA tag HG16743-CY
PCIF1 cDNA ORF Clone, Human, N-HA tag HG16743-NY
PCIF1 cDNA ORF Clone, Human, C-Myc tag HG16743-CM
PCIF1 cDNA ORF Clone, Human, N-Myc tag HG16743-NM
info info
添加购物车成功! 添加购物车失败!