MYL9 cDNA ORF Clone, Ferret, C-Myc tag

Cat: FG60111-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MYL9 Reagents
CRO Services
Product recommended

All MYL9 Reagents
MYL9 cDNA ORF Clone, Ferret, C-Myc tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
519 bp
Description
Full length Clone DNA of Ferret myosin, light chain 9, regulatory with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MYL9 Background Information
Full Name
myosin, light chain 9, regulatory

MYL9 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
MYL9 cDNA ORF Clone in Cloning Vector, Ferret FG60111-G
MYL9 cDNA ORF Clone, Ferret, untagged FG60111-UT
MYL9 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60111-ACGLN
MYL9 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60111-ACG
MYL9 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60111-ANG
MYL9 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60111-ACR
MYL9 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60111-ANR
MYL9 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60111-CF
MYL9 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60111-NF
MYL9 cDNA ORF Clone, Ferret, C-His tag FG60111-CH
MYL9 cDNA ORF Clone, Ferret, N-His tag FG60111-NH
MYL9 cDNA ORF Clone, Ferret, C-HA tag FG60111-CY
MYL9 cDNA ORF Clone, Ferret, N-HA tag FG60111-NY
MYL9 cDNA ORF Clone, Ferret, N-Myc tag FG60111-NM

MYL9 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MYL9 cDNA ORF Clone in Cloning Vector, Mouse MG52867-G
MYL9 cDNA ORF Clone, Mouse, untagged MG52867-UT
MYL9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52867-ACGLN
MYL9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52867-ACG
MYL9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52867-ACR
MYL9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52867-CF
MYL9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52867-NF
MYL9 cDNA ORF Clone, Mouse, C-His tag MG52867-CH
MYL9 cDNA ORF Clone, Mouse, N-His tag MG52867-NH
MYL9 cDNA ORF Clone, Mouse, C-HA tag MG52867-CY
MYL9 cDNA ORF Clone, Mouse, N-HA tag MG52867-NY
MYL9 cDNA ORF Clone, Mouse, C-Myc tag MG52867-CM
MYL9 cDNA ORF Clone, Mouse, N-Myc tag MG52867-NM
info info
添加购物车成功! 添加购物车失败!