MID1IP1 cDNA ORF Clone, Ferret, C-Myc tag

Cat: FG60145-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MID1IP1 Reagents
CRO Services
Product recommended

All MID1IP1 Reagents
MID1IP1 cDNA ORF Clone, Ferret, C-Myc tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
552 bp
Description
Full length Clone DNA of Ferret MID1 interacting protein 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MID1IP1 Background Information

MID1IP1 belongs to the SPOT14 family. It is a homodimer in the absence of THRSP. MID1IP1 interacts with ACACA and ACACB. It plays a role in the regulation of lipogenesis in liver. It up-regulates ACACA enzyme activity. MID1IP1 is required for efficient lipid biosynthesis, including triacylglycerol, diacylglycerol and phospholipid. MID1IP1 is involved in stabilization of microtubules. Its interaction with THRSP interferes with ACACA binding.

Full Name
MID1 interacting protein 1
References
  • Aipoalani DL. et al., 2010, Endocrinology. 151 (5): 2071-7.
  • Colbert CL. et al., 2010, Proc Natl Acad Sci. 107 (44): 18820-5.
  • Inoue J. et al., 2011, Mol Endocrinol. 25 (6): 995-1005.
  • MID1IP1 cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    MID1IP1 cDNA ORF Clone in Cloning Vector, Ferret FG60145-G
    MID1IP1 cDNA ORF Clone, Ferret, untagged FG60145-UT
    MID1IP1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60145-ACGLN
    MID1IP1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60145-ACG
    MID1IP1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60145-ANG
    MID1IP1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60145-ACR
    MID1IP1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60145-ANR
    MID1IP1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60145-CF
    MID1IP1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60145-NF
    MID1IP1 cDNA ORF Clone, Ferret, C-His tag FG60145-CH
    MID1IP1 cDNA ORF Clone, Ferret, N-His tag FG60145-NH
    MID1IP1 cDNA ORF Clone, Ferret, C-HA tag FG60145-CY
    MID1IP1 cDNA ORF Clone, Ferret, N-HA tag FG60145-NY
    MID1IP1 cDNA ORF Clone, Ferret, N-Myc tag FG60145-NM

    MID1IP1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MID1IP1 cDNA ORF Clone in Cloning Vector, Mouse MG51417-U
    MID1IP1 cDNA ORF Clone, Mouse, untagged MG51417-UT
    MID1IP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51417-ACG
    MID1IP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51417-ACGLN
    MID1IP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51417-ANG
    MID1IP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51417-ACR
    MID1IP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51417-ANR
    MID1IP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51417-CF
    MID1IP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51417-NF
    MID1IP1 cDNA ORF Clone, Mouse, C-His tag MG51417-CH
    MID1IP1 cDNA ORF Clone, Mouse, N-His tag MG51417-NH
    MID1IP1 cDNA ORF Clone, Mouse, C-HA tag MG51417-CY
    MID1IP1 cDNA ORF Clone, Mouse, N-HA tag MG51417-NY
    MID1IP1 cDNA ORF Clone, Mouse, C-Myc tag MG51417-CM
    MID1IP1 cDNA ORF Clone, Mouse, N-Myc tag MG51417-NM
    MID1IP1 qPCR Primer Pairs, Mouse MP201301

    MID1IP1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    MID1IP1 cDNA ORF Clone in Cloning Vector, Human HG14005-G
    MID1IP1 cDNA ORF Clone, Human, untagged HG14005-UT
    MID1IP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14005-ACGLN
    MID1IP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14005-ACG
    MID1IP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14005-ANG
    MID1IP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14005-ACR
    MID1IP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14005-ANR
    MID1IP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14005-CF
    MID1IP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14005-NF
    MID1IP1 cDNA ORF Clone, Human, C-His tag HG14005-CH
    MID1IP1 cDNA ORF Clone, Human, N-His tag HG14005-NH
    MID1IP1 cDNA ORF Clone, Human, C-HA tag HG14005-CY
    MID1IP1 cDNA ORF Clone, Human, N-HA tag HG14005-NY
    MID1IP1 cDNA ORF Clone, Human, C-Myc tag HG14005-CM
    MID1IP1 cDNA ORF Clone, Human, N-Myc tag HG14005-NM
    MID1IP1 qPCR Primer Pairs, Human HP102661
    info info
    添加购物车成功! 添加购物车失败!