METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, C-His tag

Cat: FG60040-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All METTL3/Methyltransferase like 3 Reagents
CRO Services
Product recommended

All METTL3/Methyltransferase like 3 Reagents
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, C-His tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
1743 bp
Description
Full length Clone DNA of Ferret methyltransferase like 3 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

METTL3/Methyltransferase like 3 Background Information
Full Name
methyltransferase like 3

METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
METTL3/Methyltransferase like 3 cDNA ORF Clone in Cloning Vector, Ferret FG60040-G
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, untagged FG60040-UT
METTL3/Methyltransferase like 3 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60040-ACGLN
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60040-ACG
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60040-ANG
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60040-ACR
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60040-ANR
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60040-CF
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60040-NF
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, N-His tag FG60040-NH
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, C-HA tag FG60040-CY
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, N-HA tag FG60040-NY
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, C-Myc tag FG60040-CM
METTL3/Methyltransferase like 3 cDNA ORF Clone, Ferret, N-Myc tag FG60040-NM

METTL3/Methyltransferase like 3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
METTL3/Methyltransferase like 3 cDNA ORF Clone in Cloning Vector, Rat RG8A0949-U
METTL3/Methyltransferase like 3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0949-ACGLN
info info
添加购物车成功! 添加购物车失败!