Quick Order

Text Size:AAA

Ferret HLA class II histocompatibility antigen, DR alpha chain-like Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Ferret LOC101696093 cDNA Clone Product Information
NCBI RefSeq:XM_004827840.1
RefSeq ORF Size:765bp
cDNA Description:Full length Clone DNA of Mustela putorius furo (sub-species: furo) HLA class II histocompatibility antigen, DR alpha chain-like with C terminal His tag.
Gene Synonym:LOC101696093
Species:Ferret
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ferret HLA class II histocompatibility antigen, DR alpha chain-like Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Ferret HLA class II histocompatibility antigen, DR alpha chain-like Gene ORF cDNA clone expression plasmid, C-GFPSpark tagFG60103-ACG$225
Ferret HLA class II histocompatibility antigen, DR alpha chain-like Gene ORF cDNA clone expression plasmid, C-OFPSpark tagFG60103-ACR$225
Ferret HLA class II histocompatibility antigen, DR alpha chain-like Gene ORF cDNA clone expression plasmid, C-Flag tagFG60103-CF$195
Ferret HLA class II histocompatibility antigen, DR alpha chain-like Gene ORF cDNA clone expression plasmid, C-His tagFG60103-CH$195
Ferret HLA class II histocompatibility antigen, DR alpha chain-like Gene ORF cDNA clone expression plasmid, C-Myc tagFG60103-CM$195
Ferret HLA class II histocompatibility antigen, DR alpha chain-like Gene ORF cDNA clone expression plasmid, C-HA tagFG60103-CY$195
Ferret HLA class II histocompatibility antigen, DR alpha chain-like Gene ORF cDNA clone in cloning vectorFG60103-G$75
Ferret HLA class II histocompatibility antigen, DR alpha chain-like Gene ORF cDNA clone expression plasmid, N-Flag tagFG60103-NF$195
Ferret HLA class II histocompatibility antigen, DR alpha chain-like Gene ORF cDNA clone expression plasmid, N-His tagFG60103-NH$195
Ferret HLA class II histocompatibility antigen, DR alpha chain-like Gene ORF cDNA clone expression plasmid, N-Myc tagFG60103-NM$195
Ferret HLA class II histocompatibility antigen, DR alpha chain-like Gene ORF cDNA clone expression plasmid, N-HA tagFG60103-NY$195
Ferret HLA class II histocompatibility antigen, DR alpha chain-like Gene ORF cDNA clone expression plasmidFG60103-UT$195
 Learn more about expression Vectors
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"