RAB7A cDNA ORF Clone, Ferret, C-Myc tag

Cat: FG60150-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RAB7A Reagents
CRO Services
Product recommended

All RAB7A Reagents
RAB7A cDNA ORF Clone, Ferret, C-Myc tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
624 bp
Description
Full length Clone DNA of Ferret ras-related protein Rab-7a-like with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB7A Background Information
Full Name
RAB7A, member RAS oncogene family

RAB7A cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
RAB7A cDNA ORF Clone in Cloning Vector, Ferret FG60150-G
RAB7A cDNA ORF Clone, Ferret, untagged FG60150-UT
RAB7A cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60150-ACG
RAB7A cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60150-ANG
RAB7A cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60150-ACR
RAB7A cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60150-ANR
RAB7A cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60150-CF
RAB7A cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60150-NF
RAB7A cDNA ORF Clone, Ferret, C-His tag FG60150-CH
RAB7A cDNA ORF Clone, Ferret, N-His tag FG60150-NH
RAB7A cDNA ORF Clone, Ferret, C-HA tag FG60150-CY
RAB7A cDNA ORF Clone, Ferret, N-HA tag FG60150-NY
RAB7A cDNA ORF Clone, Ferret, N-Myc tag FG60150-NM

RAB7A cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
RAB7A cDNA ORF Clone in Cloning Vector, Cynomolgus CG90388-G
RAB7A cDNA ORF Clone, Cynomolgus, untagged CG90388-UT
RAB7A Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90388-ACGLN
RAB7A cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90388-ACG
RAB7A cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90388-ANG
RAB7A cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90388-ACR
RAB7A cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90388-ANR
RAB7A cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90388-CF
RAB7A cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90388-NF
RAB7A cDNA ORF Clone, Cynomolgus, C-His tag CG90388-CH
RAB7A cDNA ORF Clone, Cynomolgus, N-His tag CG90388-NH
RAB7A cDNA ORF Clone, Cynomolgus, C-HA tag CG90388-CY
RAB7A cDNA ORF Clone, Cynomolgus, N-HA tag CG90388-NY
RAB7A cDNA ORF Clone, Cynomolgus, C-Myc tag CG90388-CM
RAB7A cDNA ORF Clone, Cynomolgus, N-Myc tag CG90388-NM

RAB7A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RAB7A cDNA ORF Clone in Cloning Vector, Rat RG80629-U
RAB7A cDNA ORF Clone, Rat, untagged RG80629-UT
RAB7A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80629-ACG
RAB7A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80629-ACGLN
RAB7A cDNA ORF Clone, Rat, N-GFPSpark® tag RG80629-ANG
RAB7A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80629-ACR
RAB7A cDNA ORF Clone, Rat, N-OFPSpark® tag RG80629-ANR
RAB7A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80629-CF
RAB7A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80629-NF
RAB7A cDNA ORF Clone, Rat, C-His tag RG80629-CH
RAB7A cDNA ORF Clone, Rat, N-His tag RG80629-NH
RAB7A cDNA ORF Clone, Rat, C-HA tag RG80629-CY
RAB7A cDNA ORF Clone, Rat, N-HA tag RG80629-NY
RAB7A cDNA ORF Clone, Rat, C-Myc tag RG80629-CM
RAB7A cDNA ORF Clone, Rat, N-Myc tag RG80629-NM
RAB7A qPCR Primer Pairs, Rat RP300593

RAB7A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB7A cDNA ORF Clone in Cloning Vector, Human HG16168-G
RAB7A cDNA ORF Clone, Human, untagged HG16168-UT
RAB7A cDNA ORF Clone, Human, C-GFPSpark® tag HG16168-ACG
RAB7A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16168-ACGLN
RAB7A cDNA ORF Clone, Human, N-GFPSpark® tag HG16168-ANG
RAB7A cDNA ORF Clone, Human, C-OFPSpark® tag HG16168-ACR
RAB7A cDNA ORF Clone, Human, N-OFPSpark® tag HG16168-ANR
RAB7A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16168-CF
RAB7A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16168-NF
RAB7A cDNA ORF Clone, Human, C-His tag HG16168-CH
RAB7A cDNA ORF Clone, Human, N-His tag HG16168-NH
RAB7A cDNA ORF Clone, Human, C-HA tag HG16168-CY
RAB7A cDNA ORF Clone, Human, N-HA tag HG16168-NY
RAB7A cDNA ORF Clone, Human, C-Myc tag HG16168-CM
RAB7A cDNA ORF Clone, Human, N-Myc tag HG16168-NM
RAB7A qPCR Primer Pairs, Human HP104937
info info
添加购物车成功! 添加购物车失败!